HIV Databases HIV Databases home HIV Databases home
HIV sequence database



Advanced Consensus Explanation

Introduction

Consensus Maker takes an input file of aligned DNA or protein sequences in most standard formats and calculates a consensus sequence. You have the option to download the consensus alone, or to prepend the consensus to the original alignment. If the input alignment comprises blocks of sequences (e.g., HIV sequences grouped by subtype), then the program can calculate a consensus for each sequence block and a consensus of the consensuses. The program recognizes sequence blocks by how the component sequences are named.

A good way to understand the options available is to click the Sample Input button on the submission page. This loads a simple, hypothetical alignment (in table format) into the form:

A.seq1	A-CGTATTAG
A.seq2	A-CG-AT---
A.seq3	A-CT-CT---
A.seq4	A-TT-CX---
B.seq1	A-CG-AT---
B.seq2	A-CG-CT---
B.seq3	A-CG-TT---

You can then calculate the consensus of this alignment under varying options to see the results of those options. Each column of the Sample Input has been chosen to illustrate the effect of the various options. Using default options, the output looks like:

CON_OF_CONS  ACG-?T---
CON_A        Acg-?T---
A.seq1       ACGTATTAG
A.seq2       ACG-AT---  
A.seq3       ACT-CT---   
A.seq4       ATT-CX---   
CON_B        ACG-?T---
B.seq1       ACG-AT---   
B.seq2       ACG-CT---   
B.seq3       ACG-TT---   
Col. 1: unanimity, Col. 2: all gaps, column squeezed, Col. 3: majority, Col. 4: no majority letter but resolvable by common character, Col. 5: gaps, Col. 6: irresolvable tie in consensus, Col. 7: undefined character, Cols. 8-10: missing information (trailing blanks).


Input Options

Consensus-by-Block Options

Calculation Options

Output Options


Examples

Example of using names to identify alignment blocks:

In the table-formatted file below there are two blocks, an "A1" block and a "B" block recognizable by the "A1." and "B." (note the dot) with which the names begin. Two consensuses will be calculated for this alignment if "Do consensus for each block" is true and "Min. no. seqs. for consensus" is 3.

A1.FR.83.IIIB_A04321 aaactatcgtagctagctagctgatcgatgctagctgatcg.... etc
A1.FR.83.IIIC_A04322 aaactatcgtagctagctag------gatgctagctgatcg.... etc
A1.DE.96.POIURR_A04322 aaactatcgtagctagctag------gatgctagctgatcg.... etc
B.FR.82.LAI_K03455 aaactatcgtagctagctttctgatcgatgctagctgatcg.... etc
B._._.N833_AF76511 acactatcgtagctagctagctgatcgatgctagctgatcg.... etc
B.US.99.JK77_AF76511 acactatcgtagctagctagctgatcgatgctagctgatcg.... etc

Example of "pretty print" output:

CON                     gccagccccc tgaTGGGGGC GACaCTCCAC CATGAATCAC tCCCCTGTGA 
1a.-.COLONEL_AF290978   ---------- --TTGGGGGC GACACTCCAC CATGAATCAC CCCCCTGTGA 
1a.-.H77_AF009606       GCCAGCCCCC TGATGGGGGC GACACTCCAC CATGAATCAC TCCCCTGTGA 
1a.-.HEC278830_AJ278830 GCCAGCCCCC TGATGGGGGC GACGCTCCAC CATGAATCAC TCCCCTGTGA 

CON                     GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCaTGGCG TTAGTATGAG 
1a.-.COLONEL_AF290978   GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCATGGCG TTAGTATGAG 
1a.-.H77_AF009606       GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCATGGCG TTAGTATGAG 
1a.-.HEC278830_AJ278830 GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCGTGGCG TTAGTATGAG 

CON                     TGTCGTGCAG CCTcCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 
1a.-.COLONEL_AF290978   TGTCGTGCAG CCTCCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 
1a.-.H77_AF009606       TGTCGTGCAG CCTTCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 
1a.-.HEC278830_AJ278830 TGTCGTGCAG CCTCCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 

Example of "output aligned" output:

CON                     gccagccccc tgaTGGGGGC GACaCTCCAC CATGAATCAC tCCCCTGTGA 
1a.-.COLONEL_AF290978   .......... ..T------- ---------- ---------- C--------- 
1a.-.H77_AF009606       ---------- ---------- ---------- ---------- ---------- 
1a.-.HEC278830_AJ278830 ---------- ---------- ---G------ ---------- ---------- 

CON                     GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCaTGGCG TTAGTATGAG 
1a.-.COLONEL_AF290978   ---------- ---------- ---------- ---------- ---------- 
1a.-.H77_AF009606       ---------- ---------- ---------- ---------- ---------- 
1a.-.HEC278830_AJ278830 ---------- ---------- ---------- ----G----- ---------- 

CON                     TGTCGTGCAG CCTcCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 
1a.-.COLONEL_AF290978   ---------- ---------- ---------- ---------- ---------- 
1a.-.H77_AF009606       ---------- ---T------ ---------- ---------- ---------- 
1a.-.HEC278830_AJ278830 ---------- ---------- ---------- ---------- ---------- 

Example of formatted output (nexus):

#NEXUS

begin taxa;
dimensions ntax=4;
taxlabels
CON
1a._.COLONEL_AF290978
1a._.H77_AF009606
1a._.HEC278830_AJ278830
;
end;

begin characters;
dimensions nchar=150;
format interleave datatype=dna;
matrix
CON                     gccagccccctgaTGGGGGCGACaCTCCACCATGAATCACtCCCCTGTGA
1a._.COLONEL_AF290978   ------------TTGGGGGCGACACTCCACCATGAATCACCCCCCTGTGA
1a._.H77_AF009606       GCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATCACTCCCCTGTGA
1a._.HEC278830_AJ278830 GCCAGCCCCCTGATGGGGGCGACGCTCCACCATGAATCACTCCCCTGTGA

CON                     GGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCaTGGCGTTAGTATGAG
1a._.COLONEL_AF290978   GGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAG
1a._.H77_AF009606       GGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAG
1a._.HEC278830_AJ278830 GGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCGTGGCGTTAGTATGAG

CON                     TGTCGTGCAGCCTcCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTG
1a._.COLONEL_AF290978   TGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTG
1a._.H77_AF009606       TGTCGTGCAGCCTTCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTG
1a._.HEC278830_AJ278830 TGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTG

;
end;

last modified: Tue Apr 3 07:43 2018


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Triad National Security, LLC for the U.S. Department of Energy's National Nuclear Security Administration
© Copyright Triad National Security, LLC. All Rights Reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health