HIV Databases HIV Databases home HIV Databases home
HIV sequence database

HIV BLAST Examples


All BLAST results begin with a table of the best matches to your query sequence. Matches are excluded if the %Identity is <50% or if the length of the match is <20% of the length of the query sequence.

sample BLAST output

Output columns:

Pairwise versus Query-Blast matches output

Following the list of best matches there appears an alignment of your query sequence to its matches. There are two different styles of alignment to choose from in the pop-up menu on the BLAST search submission page.


In pairwise output, the query is matched against each single subject sequence and the identities are shown by the vertical bar ( | ) character.

Score = 541 bits (273), Expect = e-154
Identities = 273/273 (100%), Positives = 273/273 (100%)
Query: 1 gtaattagatccgccaatttcacagacaatactaaaatcataatagtacagctgaatgaa  60
Sbjct: 1 gtaattagatccgccaatttcacagacaatactaaaatcataatagtacagctgaatgaa  60
Query: 61 tctgtacaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatagga 120
Sbjct: 61 tctgtacaaattaattgtacaagacccaacaacaatacaagaaaaagtataaatatagga 120

Query-Blast matches with identities:

Query seq 1 gtaattagatccgccaatttcacagacaatactaaaatcataatagtacagctgaatgaa  60
Z29296    1 ............................................................  60
U95417  433 .............a.........g......g............................. 492
U95414  433 .....c.................g......g............................. 492
U95413  433 .............a.........g......g............................. 492
U95411  433 .............a.........g......g............................. 492
U95410  433 .............a.........g......g............................. 492
L21486   49 .............a.........g......g............................. 108
L21468   49 .............a.........g......g............................. 108
U95419  433 .............a.........g......g............................. 492
U95400  430 ............aat........g.............g............c......... 489
U95392  430 ............aat........g.............g............c......... 489
L21480   49 .............a.........g......g............................. 108
Z67943    4 ....................................g...................g...  63

Here the query is aligned against ALL sequences producing a BLAST match and the identities are shown by the dot character.

Occasionally you may see lines in the alignment that look like those below.

QUERY    121  ccaggcagagcattttatacaacaggagaaataataggagatataagtcaagcacattgt 180
AF105870 121  ............................................................ 180

This means that an "a" nucleotide occurs in sequence AF105870 at position 157. The sequence of AF105870 in the region of this insertion reads tagAgag, where the "A" marks the inserted "a". If you choose to download a file of all or part of this alignment the insertions are handled as follows. The insertion is placed into its sequence and gaps are opened in all other sequences at that point. In the example above the alignment in the region of the "a" insertion would look like:

QUERY    tag-gag
AF105870 tagagag


BLAST: return to input page.
BLAST references

last modified: Wed Jun 19 08:54 2019

Questions or comments? Contact us at

Operated by Triad National Security, LLC for the U.S. Department of Energy's National Nuclear Security Administration
© Copyright Triad National Security, LLC. All Rights Reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health