HIV Databases HIV Databases home HIV Databases home
HIV sequence database



>A1.AU.03.PS1044_Day0.DQ676872
ACCGAGCC-TGTAAACATTACTTGTATCAGACCTAACAACAATACAAGAA
AAAGTGTACGT------ATAGGACCAGGACAAACATTCTATGCAACAGGT
GAA------ATAATAGGGGATATTAGAAAAGCACATTGTGTGGTCAATAA
AACAGAATGGAATAAAAATTTGAAAAAGGTAGTTGTACAATTAAGA----
--ACATACTTTAAG---AACAAAACAATAAGCTTTACTAACCAT---TCA
GGAGGGGATCCAGAAGTTACAACACATAGTTTTAATTGTGGAGGAGAATT
>A1.RW.92.92RW008.AB253421
GTCAAGCC-TGTGAAAATTAATTGTACCAGACCTAACAACAACACAAGAA
CAAGTATACGT------ATAGGACCAGGACAATCATTCCATGCAACAGGT
GAC------ATAATAGGGGATATCAGACAAGCACATTGCAATGTCAGTAG
ATCAGAATGGAATGAAGCCTTACGACAGGTAGTTGAACAACTAAGA----
--GGACACTTTGGG---AACAAAACAATAATCTTTACTAACTCC---TCA
GGAGGGGATATAGAAATCACAACACATAGTTTTAATTGTGGAGGAGAATT
>A2.CD.97.97CDKTB48.AF286238
AATAAACC-TGTACCAATTAATTGTACCAGACCCAACAACAATACAAGAA
AAAGTATACGC------TTTGGACCAGGACAGGCCTTCTATACAAATAAT
AAC------ATAATAGGGGATATAAGACAAGCACATTGTAATATCAGCAT
AACAGAATGGAATGCCACTCTAAAAAAGGTAGTTGAACAATTAAGA----
--GAACACTTCCCT---AATAAAACAATAATCTTTAATAGCTCC---TCA
GGAGGGGACCTAGAAATTACAACACATAGTTTTAATTGTGGAGGAGAATT
>A2.CY.94.94CY017_41.AF286237
ACTAAGCC-TGTACTAATTACTTGTATCAGACCCAACAACAATACAAGAA
AAAGTATACGC------TTTGGACCAGGACAAGCCTTCTAT---ACAAAT
GAA------ATAATAGGGGACATAAGACAAGCACATTGTAATATCAACAA
AACATTATGGAATGACACTTTACAAAAGGTAGCTGAACAATTAAGA----
--GAGAAATTCCCT---AAGAAAACCATAATCTTTACTAACTCC---TCA
GGAGGGGACCCAGAAATTACAACACTTAGTTTTAATTGTGCAGGAGAATT
>B.FR.83.HXB2-LAI-IIIB-BRU.K03455
AACACATC-TGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAA
AAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGA
---------AAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAG
AGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGA----
--GAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCC---TCA
GGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATT
>B.NL.00.671_00T36.AY423387
AAGGAATC-TGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAA
AAAGTATACAT------ATAGGACCAGGGAGAGCATTTTATGCAACAGGA
GAA------ATAATAGGAGATATAAGACAAGCACATTGTAACCTTAGTAG
AGCAAAATGGAATGACACTTTAAACCAGATAGTTGGAAAATTAAGA----
--GAATTATATAAG---AATAAAACAATAGTCTTTAATTCATCC---TCA
GGAGGGGATCCAGAAATTGTAATGCACAGTTTTAATTGTAGAGGGGAATT
>B.TH.90.BK132.AY173951
AAAGAACC-TGTAGAAATTAATTGTACAAGACCTAACAACTATACAAGGA
AAAGAATAACT------ATGGGACCAGGGAGAGTATATTATACAACAGGA
GAA------ATAATAGGAGATATAAGACGAGCACATTGTAACATTAGTAG
CACAAAATGGAATAACACTTTAGGACAGATAGTTAAAAAATTAAAA----
--GAACAATTTAAC---AATAATACAATAGTCTTTAAGAAATCC---TCA
GGAGGGGACCCAGAAATTGTAATGCACAGTTTTATTTGTGGAGGGGAATT
>C.BR.92.BR025-d.U52953
AACGAATC-TGTAGAGATTAATTGTACGAGACCCAACAATAATACAAGAA
AAAGTATAAGG------ATAGGACCAGGACAAGCATTCTATGCAACAGGA
GAA------ATAATAGGAGATATAAGACAAGCACATTGTAACATTAGTAG
AACAGCATGGAACAAAACTTTACAAGAGGTAGGTAAAAAATTAGCA----
--GAGCACTTCCCT---AATAAAGCAATAAAATTTGCAAAGCAC---TCA
GGAGGAGACCTAGAAATTACAACACATAGCTTTAATTGTAGAGGAGAATT
>C.ET.86.ETH2220.U46016
AATGAATC-TGTAGAAATTACTTGTACGAGACCCAGCAATAATACAAGAG
AAAGTATAAGG------ATAGGACCAGGACAAACATTCTATGCAACAGGA
GAC------ATAATAGGAGATATAAGACAAGCACATTGTAACATTAGTGA
AGAAAAATGGAATAAAACTCTACAAAAGGTAAAGGAAAAATTACAA----
--AAGCACTTCCCT---AATAAAACAATAGAATTTAAGCCATCC---TCA
GGAGGGGACCTAGAAATTACAACACATAGCTTTAATTGTGGAGGAGAATT
>C.IN.95.95IN21068.AF067155
AATCAACC-TGTAGAAATTATGTGTACAAGACCCGACAATAATACAAGAA
AAAGTATAAGG------ATAGGACCAGGACAAACATTCTATGCAACAGGA
GAC------ATAATAGGAGACATAAGACAAGCACATTGTAACATTAGTGA
AGATAAGTGGAATGAAACTTTACAAAATGTAAGTAAAAAGTTAGCA----
--GAACACTTCCCT---AATAAAACAATAATATTTAATTCATCA---TCA
GGAGGGGACCTAGAAATTACAACACATAGCTTTAATTGTAGAGGAGAATT
>D.CD.83.ELI.K03454
AATGAATC-TGTAAAAATTACCTGTGCAAGGCCCTATCAAAATACAAGAC
AAAGAACACCT------ATAGGACTAGGGCAATCACTCTATACTACAAGA
TCAAGATCAATAATAGGA---------CAAGCACATTGTAATATTAGTAG
AGCACAATGGAGTAAAACTTTACAACAAGTAGCTAGAAAATTAGGA----
--ACCCTTCTTAAC---AAAACAATAATAAAGTTTAAACCATCC---TCA
GGAGGGGACCCAGAAATTACAACACACAGTTTTAATTGTGGAGGGGAATT
>D.TZ.01.A280.AY253311
AATGAGAC-TGTAAAAATTAATTGTACAAGGCCTAATAACAATACAAGAA
AAGGTATACGT------ATAGGACCAGGGCAAACATTCTTTACAGCAGAG
---------GTAACAGGAGATATAAGAAAAGCATATTGTAACATTAGTGG
AGCAGAATGGGATAAAACTTTACAACAAGTAGCTACAAAACTAGGA----
--GACCTTCTTAAC---AAGACAATAATAAATTTTAGTCCATCC---TCA
GGAGGGGACCCAGAAATTACAACACATAGCTTTAATTGTGGAGGGGAATT
>F1.BE.93.VI850.AF077336
AATGAATC-TGTACAGATTAATTGTACAAGACCCAACAACAATACAAGGA
AAGGTATACAT------TTAGGACCAGGACAAACATTCTATGCAACAGGA
GCA------ATAATAGGAGACATAAGAAAGGCACATTGTAACATTAGTGG
AACACAATGGAATAACACTCTGGAGTATGTAAAGGCAGAATTAAAG----
--TCGCATTTCCCTAATAATACAGCAATAAAATTTAACCAATCC---TCA
GGAGGGGACCTAGAAATTACAATGCATAGTTTTAATTGTAGAGGAGAATT
>F1.BR.93.93BR020_1.AF005494
AATGAATC-TGTACAGATTAATTGTACAAGACCCAACAACAATACAAGAA
AAAGAATATCT------TTAGGACCAGGACGAGTATTTTATACAACAGGA
GAA------ATAATAGGAGACATCAGAAAGGCACATTGTAACGTTAGTGG
AACACAATGGAGGAACACGTTAGCAAAGGTAAAGGCAAAGTTAGGG----
--TCTTATTTCCCT---AATGCAACAATAAAATTTAACTCATCC---TCA
GGAGGGGACCTAGAAATTACAAGGCATAATTTTAATTGTATGGGAGAATT
>F1.FI.93.FIN9363.AF075703
AATGAATC-TGTACAGATCAATTGTACAAGACCCAACAACAATACAAGAA
AAAGTATACGT------ATAGGACCAGGACAATCATTTTATGCAACAGGA
GAA------ATAATAGGAGACATAAGAAAGGCACATTGTAACATTAGTGG
AGAACAATGGAATAAAACTTTAGACCGAGTAAAGGCAGAGTTAAAG----
--CTTCATTTT------AATAAAACAATACAATTTAACTCATCC---TCA
GGAGGGGACCTAGAAATTACAATGCATAGTTTTAATTGTAGAGGAGAATT
>F2.CM.02.02CM_0016BBY.AY371158
AATGAATC-AGTAAAAATTAACTGTACAAGACCCAACAACAATACAAGAA
AAAGTATACGT------ATAGGACCAGGACAAGTATTTTATGCAACAGGT
GAG------ATAATAGGAGACATAAGAAAGGCACATTGTACCATTAATGG
AACACTGTGGAATGCAACTTTAAATAGGGTAGCTGCAGAGGTCAAA----
--AACCTCACT------AATATTACAATAAAATTTGAGCCATCA---TCA
GGAGGGGACCTAGAAGTTACAACACATAGTTTTAGTTGTGGAGGAGAGTT
>F2.CM.95.95CM-MP255.AJ249236
AATAGATC-TGTAATAATTGATTGTAGAAGACCCAACAACAATACAAGAA
AAGGGATACGT------ATAGGACCAGGACAAACATTCTTTGCAACAGGT
GAA------ATAATAGGGGATATAAGAAAGGCATATTGTAACATTAATAG
AACACTGTGGAATGAAACTTTAAAAAATGTAAGTGGAGAGTTCAAA----
--AAACACTTC------AACTTCTCAGTAGCCTTTAATTCATCC---TCA
GGAGGGGATGTAGAAATTACAACGCATAGTTTTAATTGTAGAGGAGAATT
>F2.CM.95.95CM-MP257.AJ249237
AAAAATCC-TGTAAAAATTAATTGTACAAGACCCAACAACAATACAAGAA
GAAGTATACAT------ATAGGACCAGGACGAGCATTCTATGCAACAGGT
GAG------ATAATAGGAGATACAAGAAAGGCACATTGTAACATTAGTGA
AAAACAGTGGTATGACACTTTAATAAAGATAGCTACAGAGTTCAAA----
--GACCAATAT------AATAAAACAGTAGGGTTTCAACCATCA---GCA
GGAGGGGATCTAGAAATTACAACACATAGTTTTAATTGTAGAGGAGAATT
>G.KE.93.HH8793_12_1.AF061641
AATGAAAC-TGTAGAAATTACGTGTGTCAGACCCAACAACAATACAAGAA
AAAGTATACAC------CTCGGGCCAGGACAAGCGCTCTATGCAACAGGG
GAC------ATAATAGGAAATATAAGACAGGCACATTGTGATGTTAGTGG
AAGAAATTGGAGTAACATGATAGAGAAGGTAAAAGCACAACTAAGA----
--AAAATCTTT------AACAAGACCATAACCTTTGACTCATCT---GCA
GGAGGGGACCTAGAAATTACAACACATAGTTTTAATTGTAGGGGAGAATT
>G.NG.92.92NG083_JV10832.U88826
AATAATAG-TATAGAAATTAATTGTATCAGACCCAATAACAATACAAGAA
AAAGTATACCA------ATCGGACCAGGACAAGCGTTCTATGCAACAGGT
GAT------ATAATAGGAGACATAAGACAAGCACATTGTAATGTTAGTAG
AATAAAATGGAGGGAGATGTTAAAGAATGTCACAGCACAGCTAAGG----
--AAAATCTATAAT---AATAAGAACATAACCTTTAACTCATCT---GCA
GGAGGGGACCTAGAAATTACAACACATAGTTTCAATTGTAGAGGAGAGTT
>H.BE.93.VI991.AF190127
AATGAACC-TGTACAAATTAACTGTACCAGAACAGGCAATAATACGAGAA
AAAGTATACGT------ATAGGGCCAGGACAAGCATTCTATGCAACAGGT
GAC------ATCATAGGAGATATAAGACGAGCATATTGTAATATTAGTGG
AAAACAATGGAATGAGACCTTACACAAGGTAATCACCAAATTAGGA----
--AGCTACTTTGAC---AATAAAACAATAATTTTACAACCACCC---GCA
GGAGGGGATATAGAGATTATAACACATAGTTTTAATTGTGGAGGAGAGTT
>H.BE.93.VI997.AF190128
GATAGTCC-TATAGAAATTACCTGTACCAGACCTAACAATAATACAAGAA
AAGGTATACAT------TTCGGGCCAGGGCAAGCATTCTATGCAACAGGT
GAT------ATCATAGGAAACATAAGACAAGCACATTGTAATGTTAGTGA
AGAGAAATGGAATAAGACTTTACAACAGATAGCTACACAATTAAGT----
--AAATACTTTGTC---AATAGAACATTAATTTTTAAACCACAC---TCA
GGAGGGGACCTGGAAGTTACAACACATAGTTTTAACTGTAGAGGAGAATT
>H.CF.90.056.AF005496
AAGACACC-AGTAAACATTACATGTACCAGGCCTAACAATAATACGAGAA
CAAGTATACAT------TTAGGGCCAGGACGAGCATTCTATGCAACAGGT
GAC------ATCATAGGAGATATAAGACAAGCACATTGTAATATTAGTAG
AACAGACTGGAATAAGACTTTACACCAGGTAGTTACACAATTAGGA----
--ATACACTTGAAC---AATAGAACAATAAGCTTTAAGCCAAAC---TCA
GGAGGGGACATGGAAGTTAGAACACATAGTTTTAATTGTAGAGGAGAATT
>J.CD.97.J_97DC_KTB147.EF614151
AACCAAAC-TGTAGAAATCAATTGTACCAGACCCGCCAACAATACAAGAA
AGGGTATACCC------ATAGGACCAGGGCAAGTGCTATATGCAACAGGT
GCA------GTAATAGGAAACATAAGACAAGCACATTGTAACATTAGTGG
AGTAAAATGGAATAATACTTTACATAAAGTAGCTGAAGAATTAAGAGAAC
AAGAACACTTTAAG---AATAAAACAATAGTCTTTGCACCAGCAAATTCA
GGAGGGGACATAGAAATTATGATGCATACTTTTAATTGTGGAGGAGAGTT
>J.SE.93.SE9280_7887.AF082394
AATAAAAC-TGTAGAAATTGTGTGTTACAGACCTAATAACAATACAAGGA
AAGGTATACAC------ATGGGACCAGGACAAGTGCTCTACGCAACAGGA
GAA------ATAATAGGAAATATAAGAGAAACACATTGTAACATTAGTGA
AAGAGATTGGAGTAACACTTTACGTAGAGTAGCTACAAAACTAAGA----
--GAACACTTT------AATAAAACAATAAACTTTACATCACCC---TCA
GGAGGGGATATAGAAATTGTGACACATAGTTTTAATTGTGGAGGAGAATT
>K.CD.97.97ZR-EQTB11.AJ249235
AATGAAGC-TGTAGAAATTAATTGTACAAGGCCAAGCAACAATACAAGAA
AAAGTATACAT------ATAGGACCAGGAAGAGCATTCTATGCAACAGGT
GAC------ATAATAGGAGATATAAGGCAGGCGCATTGTAACATTAGCGG
AGGACAGTGGAATAAAACTGTAAACCAAGTAAAGAAAGAATTAGGA----
--AAACACTTT------AACAAAACAATAATATTTCAACCATCC---TCA
GGAGGGGACCCACAAGTCACAAGGCACATTTTTAACTGTAGAGGAGAATT
>K.CM.96.96CM-MP535.AJ249239
AATGAAAC-TGTACAAATTAATTGTACAAGGCCAAACAACAATACAAGAA
AAAGTATACAT------ATGGGACCAGGAAAAGCATTCTATACAACAGGT
GAT------ATAATAGGAGATATAAGACAGGCACATTGCAACATTAGTGG
AGAAAAATGGAACATGACTTTAAGCAGAGTAAAGGAAAAGCTAAAA----
--GAACATTTTAAG---AATGGAACAATAACATTTAAACCACCAAACCCA
GGAGGAGACCCAGAAATTCTAACGCACATGTTTAATTGTGCAGGAGAATT
>50_A1D.GB.10.12792.JN417240
-GCCAGCCCTGTGAACATTAGTTGTGTTAGACCTAACAACAATACAAGGA
AAAGTGTACGT------ATAGGGCCAGGACAAACATTCTATGCAAATAAT
GAC------ATAATAGGGAATATAAGACAAGCACACTGTAATGTCAGTGG
ATCAAAATGGAATAAAACTTTACAACAGGTAGCT-AGGAAATTAGGGAAC
-----CTTCTTAAC---CAGACAACAATAATTTTTAAACCATCC---TCA
GGAGGGGATCCAGAAATCACAATGCATAGTTTTAATTGTGGAGGAGAATT
>A1U.NG.10.10NG040248.KX389608
-AATAAGGCTGTAGAAATTAATTGTATCAGGCCTAACAACAATACAAGAA
AAAGCATACAT------ATAGGACCAGGACAAGCATTCTATGCAACAGGT
GAA------ATAATAGGGGATATAAGACAAGCACAGTGTGAGGTCAATAA
AACTAAATGGGATAACATGTTACAACGGGTAGCT-GCACAATTAGGAGAA
-----CTCCTTAAC---AAAACAGAAATAAACTTTAATCAATCC---GCA
GGAGGAGATATAGAAATTACAACACATAGTTTTAATTGTGGGGGAGAATT

last modified: Mon Feb 26 13:39 2018


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Triad National Security, LLC for the U.S. Department of Energy's National Nuclear Security Administration
© Copyright Triad National Security, LLC. All Rights Reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health