HIV Databases HIV Databases home HIV Databases home
HIV sequence database



SUDI Example Alignment

Below is an example of an IG formatted alignment. The Outgroup must be
labeled as such and come first! All unknown sequences need to be labeled 
U_seqID, where seqID represents the sequence name.


;
OUTGROUP
GCGGGGGCTCTTTTTGAGGGGAGAGAAGCTAGATACATGGGAAAGTATCAGCTTCGGCCCGGTGGCAAGA
AAAAGTACATGATAAAACATCTGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCT
TCTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTCCATAGAATAAGATCCCCTG
AAATAAATCTTTGTTTAACACCATTTGTGTTCTGTGGTGCGTACATAAAGGGGAAAAGATAAAAGACACA
;
U_3
GCGAGAGCTCATATTAAGCGGGGGAAAATTAGATGCATGGGAGAAAATTCGTTAAGGCCAGGGGGAAAGA
AACAATATAGAATGAAACATCTAGTATGGGCAAGCAGAGAGCTAGAAAGATTCGCAGTTAACCCTGGCCT
TTTAGAAACAGCAGAGGGGTGTCAACAAATACTGGAACAGTTACAACCAGCTCTCAAACAGGATCAGAAG
AACTTAATCATTATATAATACAGTAGCAACCCTTTATTGTGTACATCAAAGGATAGATGTAAGAGACACC
;
A_KE.Q2317
GCGAGAGCTCATATTAAGCGGGGGAAAATTCGATGCATGGGAGAAAATTCGTTAAGGCCAGGGGGAAAGA
AAAAATATAGAATGAAGCATCTAATATGGGCAAGCAGGGAGCTGGACAGATTTGCACTTAACCCTAGCCT
TTTAGAAACAGCAGACGGATGTCAACAAATAATGGAAAAATTACAACCAGCTCTCAAACAGGAACAGAAG
AAATAAATCATTATTTAATACTGTAGCAACCCTCTATTGTGTACATCAACGGATAGATGTAAAAGACACC
;
A_SE.UGSE8891
GCGAGAGCTCAAATTAAGTGGGGAAAAAAAAGATGCTTGGGAGAAAATGCGTTAAGGCCAGGGGGAAAGA
AAAAATATAAACTGAAACATATGGTATGGGCAAGAAGGGAGCTGGAAAAATCCGCACTTAACCCTAGCCT
TTTAGAAACAACAGAAGGATGTCAACAAATAATGGATAAATTACAACCAGCTCTCAGACAGGAACAGAAG
AACTTAATCACTATATAATACAGTAGCAACCCTCTATTGCGTACATCAAAAGATAGCTGTAAAAGACACC
;
A_UG.U455
GCGAGAGCTCATATTAAGCGGGAAAAAATTAGATTCATGGGAGAAAATTCGTTAAGGCCAGGGGGAAACA
AAAAATATAGACTGAAACATTTAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCT
TTTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGCTCTCCAACAGGAACAGAAG
AACTTAATCATTATATAATACAGTAGCAGTCCTCTATTGTGTACATCAAAGGATAGATGTAAAAGACACC
;
B_AU.MBC925
GCGAGAGCTCATATTAAGCGGGGGAGAATTAGATAGATGGGAAAGAATTCGTTAAGGCCAAGGGGAAAGA
AAAAATATCAATTAAAACATATAGTATGGGCAAGCAGGGAGCTGGAACGATTCTCAGTTAATCCTGGCCT
GTTAGAAACATCAGAAGGCTGTAGACAAATACTGAGACAGCTACAACCAGCCCTTCAACAGGATCAGAAG
ACTTTAATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGGTAAAAGACACC
;
B_CN.RL42
GCGAGAGCTCATATTAAGCGGGGGACAATTAGATAGATGGGAAAAAATTCGTTAAGGCCAGGGGGAAAGA
AAAAATATAGATTAAAACATCTAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCT
GTTAGAAACATCAGAAGGCTGTAGACAAATACTGGAACAGCTACAACCAGCCCTTCAACAGGATCAGAAG
AACTTAATCATTATTCAATACAGTAGCAACCCTCTATTGTGTGCATCTAAGGATAGAGATAAAAGACACC
;
B_DE.HAN2
GCGAGAGCTCATATTAAGCGGGGGAGAATTAGACAAATGGGAAAAAATTCGTTAAGGCCAGGGGGAAAGA
AAAAATATCAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCT
GTTAGAAACATCAGAAGGCTGTAGACAGATAATGGGACAGCTACAACCGTCCCTTCAACAGGATCAGAAG
AACTTAATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAAGATAGAGGTAAAAGACACC
;
C_BR.92BR025
GCGAGAGCTCATATTAAGAGGCGGAAAATTAGATGCTTGGGAAAGAATTAATTAAAGCCAGGGGGAAAGA
AACACTATATGATGAAACACCTAGTCTGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTGACCCTGGCCT
TTTAGAGACATCCGAAGGCTGTAAACAAATAATGAAACAGCTACAACCAGCTCTTCAACAGGAACAAAGG
AACTTAATCATTACATAATACGGTTGCAACTCTCTATTGTGTACATGAAAAGATAGATGTACGAGACACC
;
C_BW.96BW0402
GCGAGAGCTCATATTAAGAGGGGGAAAATTAGATGCATGGGAAAAAATTAGTTAAGGCCAGGGGGAAAGA
AACAATATAGGATAAAACACCTAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTAACCCTGGCCT
TTTAGAAACATCAGAAGGCTGTAAACAAATAATACAACAGCTACAACCAGCTCTTCAACAGGAACAGAGG
AACTTAATCATTATTTAACACAGTAGCAACTCTCTATTGTGTACATAAAAAGATAGAGGTACGAGACACC
;
C_ET.ETH2220
GCGAGAGCTCATATTAAGAGGCGAAAAATTAGATGCCTGGGAAAAAATTAATTAAGGCCAGGGGGAAAGA
AACACTATATGCTGAAACACCTAGTCTGGGCAAACAGGGAGCTGGAAAAATTTGCACTTAACCCTGACCT
TTTAGATACATCAGCAGGCTGTAAACAAATAATTAAACAGCTACAACCAGCTCTTCAACAGGAACAGAGG
AACTTAATCATTATTTAATACAGTGGCAACTCTCTATTGTGTACATCAAAAGATAGAGATAAAAGACACC
;
G_BE.DRCBL
GCGAGAGCTCATATTAAGCGGGGGAAAATTAGATGCTTGGGAGAAAATTCGTTGAGGCCAGGGGGAAAGA
AAAGATATAGAATGAAACATTTAGTATGGGCAAGCAGGGAGCTGGACAGATTTGCACTTAACCCTGGCCT
TTTAGAAACAGCAGAAGGTTGTCAAAAAATAATGGCACAGTTGCAACCAGCTCTCCAACAGGAACAGAGG
AGATTAATCACTATTTAATACAGTAGCAACCCTCTATTGTGTACATCAAAAGATAGAGGTAAGAGACACC
;
G_FI.HH87932
GCGAGAGCTCATATTAAGCGGGGGAAAATTAGATGCATGGGAAAAAATTCGCTGACGCCAGGGGGAAAGA
AAAAATACAGACTGAAACATCTAGTATGGGCAAGCAGAGAGATGGAGAGATTTGCACTTAACCCTGGCCT
TTTAGAAACAGCAGAAGGTTGTCAACAAATAATGAGCCAGTTGCAACCAGCTATCCAACAGGAACAGAGG
AGATTAATCATTATTTAATACAGTAGCAACCCTCTATTGTGTACATCCCAAGATAGAGGTAAAGGACACC
;
G_NG.92NG083
GCGAGAGCTCATATTAAGCGGGGGAAAATTAGATTCTTGGGAAAAAATTCGTTAAGGCCAGGGGGAAGGA
AAAAGTATAAACTAAAACATATAGTATGGGCAAGCAGGGAACTGGGGAGATTTGCACTTAACCGTGACCT
TTTAGAAACAGCAGAAGGTTGTGTGCAAATAATGAAACAGTTGCAACCAGCTCTCTAACAGGAACAGAGG
AGCTTAATCATTATTTAATACAGTAGCAACCCTCTACTGTGTACATCAAAAGATAGAGGTAAAAGACACC
;
G_SE.SE6165
GCGAGAGCTCATATTAACCGGGGGAAAATTAGATGCTTGGGAAAAAATTCGTTGAGGCCAGGGGGAAGGA
AATCATATAAAATAAAACATCTAGTATGGGCAAGCAGGGAGCTGGAGAGATTTGCACTTAACCCTGACCT
TTTAGAAACAGCAGAAGGTTGTCAACAAATAATGAGACAGTTGCAACCATCTCTCCAACAGGAACAGAGG
AAATTAATCATTATATAATGCAGTAGCAACCCTCTATTGTGTACATCAAAGGATAGAGGTAAAAGACACC
;
K_ZR.EQTB11C
GCGAGAGCTCATATTAAGCGGGGGAAAATTAGACAAATGGGAAAAAATTCATTACGGCCAGGGGGAAAGA
AAAAATACAGGCTAAAACATCTAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCACTTAACCCTAACCT
TTTAGAGACAGTAGAAGGCTGTCGGCAAATAATAAGACAACTACAACCATCCCTTCAACAGGCTCGGAAG
AGCTTAATCACTATTTAATACAGTAGCAACCCTCTATTGGGTGCATCAAAGTATACAGGTAAGGGACACC

last modified: Thu Nov 8 11:14 2007


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health