HIV Databases HIV Databases home HIV Databases home
HIV sequence database



QC/GenBank Tool Example Files

1. Sequences example (fasta file):

>mysample_1
TGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTA
GCAGTGGCGCCCGAACAGGGACTTGAAAGTGAAAGAGAAACCAGAGGAGC
TCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAG
GGGCGGCGACTGGTGAGGACGCCAAAATTTTGACTAGCGGAGGCTAGAAG
GAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGACA
AATGGGAAAAAATTCGGTTAAGGCCAGGAGGAAGAAAACAGTACAAATTA
AAACATATAGTATGGGCAAGCAGGGAACTAGAACGATTCGCAGTTAATCC
TGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATAATGGGACAGCTAC
AACCAGCCCTCCAGACAGGATCAGAAGAACTTAGATCATTATATAATACA
GTAGCAGTCCTCTATTGTGTGCATCAAAGAATAGATGTAAAAGACACCAA
>mysample_2
TGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTA
GCAGTGGCGCCCGAACAGGGACTTGAAAGTGAAAGAGAAACCAGAGGAGC
TCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAG
GGGCGGCGACTGGTGAGTACGCCAAAATTTTGACTAGCGGAGGCTAGAAG
GAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGACA
AATGGGAAAAAATTCGGTTAAGGCCAGGAGGAAGAAAACAGTACAAATTA
AAACATATCGTATGGGCAAGCAGGGAACTAGAACGATTCGCAGTTAATCC
TGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATAATGGGACAGCTAC
AACCAGCCCTCCAGACAGGATCAGAAGAACTTAGATCATTATATAATACA
GTAGCAGTCCTCTATTGTGTGCATCAAAGAATAGATGTAAAAGACACCAA
>mysample_3
TGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTA
GCAGTGGCGCCCGAACAGGGACTTGAAAGTGAAAGAGAAACCAGAGGAGC
TCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAG
GGGCGGCGACTGGTGAGTACGCCAAAATTTTGACTAGCGGAGGCTAGAAG
GAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGACA
AATGGGAAAAAATTCGGTTAAGGCCAGGAGGAAGAAAACAGTACAAATTA
AAACATATAGTATGGGCAAGCAGGGAACTAGAACGATTCGCAGTTAATCC
TGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATAATGGGACAGCTAC
AACCAGCCCTCCAGACAGGATCAGAAGAACTTAGATCATTATATAATACA
GTAGCAGTCCTCTATTGTGTGCATCAAAGAATAGATGTAAAAGACACCAA
>mysample_4
TGGTAACTAGAGATCCCTCAGACCATTTTGGTAGTGTGGAAAATCTCTAG
CAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGTAAGACCAGAGGAGAT
CTCTCGACGCAGGACTCGGCTTGCTGAAGTGCACACGGCAAGAGGCGAGA
GCGGCGACTGGTGAGTACGCCGAATTTTTGTCTGACTAGCGGAGGCTAGA
AGGAGAGAGATGGGTGCGAGAGCGTCAATATTAAAAGGGGGAAAGTTAGA
TACATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATATGC
TAAAACATCTAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTAAC
CCTGGCCTTTTAGAAACATCAGAAGGGTGTAAACAAATAATGAAACAGCT
ACAACCAGCTCTTCAGACAGGGACAGAGGAACTTAGATCATTATTTAACA
CAGTAGCAACTCTCTATTGTGTACATGAAAAGATAGAGGTACGAGACACC
>mysample_5
TGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTA
GCAGTGGCGCCCGAACAGGGACTTGAAAGTGAAAGAGAAACCAGAGGAGC
TCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAG
GGGCGGCGACTGGTGAGTACGCCAAAATTTTGACTAGCGGAGGCTAGAAG
GAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGACA
AATGGGAAAAAATTCGGTTAAGGCCAGGAGGAAGAAAACAGTACAAATTA
AAACATATAGTATGGGCAAGCAGGGAACTAGAACGATTCGCAGTTAATCC
TGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATAATGGGACAGCTAC
AACCAGCCCTCCAGACAGGATCAGAAGAACTTAGATCATTATATAATACA
GTAGCAGTTCTCTATTGTGTGCATCAAAGAATAGATGTAAAAGACACCAA
>mysample_6
TGGTAACTAGAGATCCCTCAGACCAATTAGTCAGTGTGGAAAATCTCTAG
CAGTGGCGCCCGAACAGGGACCGGAAAGCGAAAGAGAAACCAGAGGAGCT
CTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGG
GGCGGCGACTGGTGAGTACGCCGAAAATTTTTGACTAGCGGAGGCTAGAA
GGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGAT
AGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATCAATT
AAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAACC
CTGGCCTGTTAGAAACATCAGAAGGATGTAGACAAATACTGGGACAGCTA
CAACCAGCCCTTCAGACAGGATCAGAAGAACTTAAATCATTATATAATAC
AGTAGCGACCCTCTATTGTGTGCATCAAAAGATAGATGTAAAAGATACCA

2. Annotation example (CSV file):

Sequence name,Sample date,Sample country,Subtype,Patient code,Patient sex,Fiebig stage,Viral load,CD4 count,Days post-infection,Sample city,Culture method,Sample tissue,HLA type,Risk factor,Patient health status
mysample_1,30-Mar-2010,GB,B,pcode1,M,2,2362147,247,21,London,uncultured,plasma,A*0201 A*3101 B*4402 B*5701 Cw*0501 Cw*0302,PH,asymptomatic
mysample_2,3-Oct-2009,GB,B,pcode2,F,3,4200,325,46,London,cultured,semen,A*0201 A*3101 B*4402 B*5701 Cw*0501 Cw*0302,SG,acute infection
mysample_3,Apr-2009,GB,B,pcode3,F,4,87287,818,181,London,uncultured,plasma,A02 A34 B*4403 B*4403 Cw*0401 Cw*0701,PH,symptomatic
mysample_4,May-2009,US,B,pcode4,M,5,203,46,28,Boston,primary,plasma,A*0201 A*3101 B*4402 B*5701 Cw*0501 Cw*0302,PB,AIDS
mysample_5,2008,US,B,pcode5,M,6,980123,999,221,Boston,uncultured,plasma,A*0201 A*3101 B*4402 B*5701 Cw*0501 Cw*0302,EX,acute infection
mysample_6,2000,US,B,pcode6,M,1 or 2,36247,360,79,Boston,uncultured,plasma,A*0201 A*3101 B*4402 B*5701 Cw*0501 Cw*0302,PH,acute infection

last modified: Tue May 21 09:29 2013


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health