HIV Databases HIV Databases home HIV Databases home
HIV sequence database



; A-U455 AGGATTAGATCTGAAAATTTCACAAACAATGCAAAAACCATAATAGTACAGCTTGTCAATCCTGTAAAAA TCAATTGTTCCAGACCTTAC---AATACAAGAAAAAATATACGTAGGTATAGTATAGGATCAGGACAAGC ATTCTATGTA---ACAGGTAAA------ATAATAGGGGATATA---AGACAAGCACATTGTAATGTCAGT AGAAGGGACTGGAATAGAACTATACAACAGGTAGCTGAACAATTAAAGAAA---------AAGTTTAATA AC---------AAAACA ; A-92UG037.1 ATGATTAGATCTGAAAATATCACAAACAATGTCAAAAACATAATAGTACAACTTAACGAGTCTGTAACAA TTAATTGTACCAGACCTAACAATAATACAAGAAGAAGTGTACGTATA---------GGACCAGGACAAAC ATTCTATGCA---ACAGGTGAT------ATAATAGGGGATATA---AGACAAGCACATTGTAATGTCAGT GGGTCACAATGGAATAAAACTTTACACCAGGTAGTTGAACAATTAAGAAAA---------TATTGGAACA AC---------AATACA ; A-KENYA ATGATTAGATCTGAAAATATCACAAACAATGCCAAAAATATAATAGTACAATTTGCCGAGCCTGTAAAAA TTAATTGTACCAGACCTAACAACAATACAAGAATGAGTATACGTATA---------GGACCAGGACAAGC ATTCTATGCA---ACAGGTGAC------ATAATAGGGAACATA---AGACAAGCACATTGTAATGTCAGT AGAGCAGAATGGAATACAACTTTGCAAAAGGTAGTCACAAAATTAAGGGAA---------TACTTTGGGA ACAAC------AAAACA ; A-SF1703 AAGATTAGATCTGAAAATATCACAAACAATGCCAAAACCATAATAGTACAACTTAACAAGACTGTAGAAA TTAATTGTACCAGACCTAACAACAATACAAGAAAAAGTGTACGTATA---------GGACCAGGACAAGC ATTCTATGCA---ACAGGTGAC------ATAATAGGGGATATA---AGACAAGCATATTGTAATGTCAGT AGAGCAGACTGGAATAAAACTTTACAAGGGGTAGCCAACCAATTAAAAAGT---------TACTTTAGTA AC---------AAAACA ; B-HXB2 GTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAA TTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGA---GGACCAGGGAGAGC ATTTGTTACA---ATAGGAAAA---------ATAGGAAATATG---AGACAAGCACATTGTAACATTAGT AGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAA---------CAATTTGGAA ATAAT------AAAACA ; B-JRFL GTAATTAGATCTGACAATTTCACGAACAATGCTAAAACCATAATAGTACAGCTGAAAGAATCTGTAGAAA TTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATACATATA---------GGACCAGGGAGAGC ATTTTATACT---ACAGGAGAA------ATAATAGGAGATATA---AGACAAGCACATTGTAACATTAGT AGAGCAAAATGGAATGACACTTTAAAACAGATAGTTATAAAATTAAGAGAA---------CAATTTGAGA AT---------AAAACA ; B-OYI ATAATTAGATCTAGCAATTTCACAAACAATGCTAAAATCATAATAGTACAGCTGAATAAATCTGTAGAAA TTAATTGTACAAGACCCAACAACAATACAAGAAACAGGATATCAATA---------GGACCAGGGAGAGC ATTTCATACA---ACAAAACAA------ATAATAGGAGATATA---AGACAAGCACATTGTAACCTTAGT AGAGCAACATGGGAGAAAACTTTAGAACAGATAGCTACAAAATTAAGAAAA---------CAATTTAGGA AT---------AAAACA ; B-RF GTAATTAGATCTGAAAATTTCACGGACAATGTTAAAACCATAATAGTACAGCTGAATGCATCTGTACAAA TTAATTGTACAAGACCCAACAACAATACAAGAAAAAGTATAACTAAG---------GGACCAGGGAGAGT AATTTATGCA---ACAGGACAA------ATAATAGGAGATATA---AGAAAAGCACATTGTAACCTTAGT AGAGCACAATGGAATAACACTTTAAAACAGGTAGTTACAAAATTAAGAGAA---------CAATTTGACA AT---------AAAACA ; C-ETH2220 ATAATTAGATTTGAAAATCTGACAAACAATGCCAAAATAATAATAGTACAGCTTAATGAATCTGTAGAAA TTACTTGTACGAGACCCAGCAATAATACAAGAGAAAGTATAAGGATA---------GGACCAGGACAAAC ATTCTATGCA---ACAGGAGAC------ATAATAGGAGATATA---AGACAAGCACATTGTAACATTAGT GAAGAAAAATGGAATAAAACTCTACAAAAGGTAAAGGAAAAATTACAAAAG---------CACTTCCCTA AT---------AAAACA ; C-92BR025.8 ATAATTAGATCTAAAAATCTAACAGACAATGTCAAAACAATAATAGTACATCTTAACGAATCTGTAGAGA TTAATTGTACGAGACCCAACAATAATACAAGAAAAAGTATAAGGATA---------GGACCAGGACAAGC ATTCTATGCA---ACAGGAGAA------ATAATAGGAGATATA---AGACAAGCACATTGTAACATTAGT AGAACAGCATGGAACAAAACTTTACAAGAGGTAGGTAAAAAATTAGCAGAG---------CACTTCCCTA AT---------AAAGCA ; C-UG268 ATAATTAGATCTGAAAATCTGACAAATAATGCCAAAATAATAATAGTACAGCTTAACAAATCTGTAGAAA TTAATTGTGCGAGACCCAACAATAATACAAGAGAAAGTATAAGGATA---------GGACCAGGACAAAC ATTCTATGCA---ACAGGAGAC------ATAATAGGAGATATA---AGACAAGCATACTGTAACATTAGT AGAAATGAATGGAATATAACTTTACAATGGGTAAGAGAAAAATTAAAAAGG---------CACTTCCCTA AT---------AAAACA ; C-ZAM18 ATAATTAGGTCTGAAAATCTAACAAACAATGCCAAAACAATAATAGTACATCTTAATGAATCTGTAGAAA TTGTGTGTACAAGACCCAGCAATAATACAAGAAAAAGTATAAGGATA---------GGACCAGGACAAGC ATTCTATGCA---ACAGGTGGC------ATAATAGGAAACATA---AGACAAGCACATTGTAACATTAGT AAAGAGAACTGGAATAAAACTTTACAAAAGGTAGGAAAAAAATTAGCAGAG---------CACTTCCCTA AT---------AAAACA ; D-NDK ATAATTAGATCTGAAAATCTCACAAACAATGTTAAAACCATAATAGTACAGCTTAATGCATCTATAGTAA TTAATTGTACAAGGCCCTACAAATATACAAGGCAAAGGACATCGATA---------GGACTAAGGCAATC ACTCTATACAATAACAGGAAAAAAGAAGAAAACAGGATACATA---GGACAAGCACATTGTAAAATTAGC AGAGCAGAATGGAATAAAGCTTTACAACAGGTAGCTACAAAACTAGGAAAC---------CTTCTTAACA AA---------ACAACA ; D-Z2Z6 ATAATTAGATCTGAAAACCTCACAAACAATGCTAAAATCATAATAGTACAGCTCAATGAGTCTGTAGCAA TTAACTGTACAAGGCCCTACAGAAATATAAGACAAAGGACATCTATA---------GGATTAGGGCAAGC GCTCTATACA---ACA---AAA------ACAAGAAGTATAATA---GGACAAGCATATTGTAATATTAGT AAAAATGAATGGAATAAGACATTACAACAGGTAGCTATAAAATTAGGAAAC---------CTTCTTAACA AA---------ACAACA ; D-ELI ATAATTAGATCCGAAAATCTCACAAACAATGCTAAAAACATAATAGCACATCTTAATGAATCTGTAAAAA TTACCTGTGCAAGGCCCTATCAAAATACAAGACAAAGAACACCTATA---------GGACTAGGGCAATC ACTCTATACT---ACA---AGA------TCAAGATCAATAATA---GGACAAGCACATTGTAATATTAGT AGAGCACAATGGAGTAAAACTTTACAACAAGTAGCTAGAAAATTAGGAACC---------CTTCTTAACA AA---------ACAATA ; D-94UG114.1 ATAATTAGATCTGAAAATCTCACAAACAATGCTAAAATCATAATAGTACAGCTTAATGAGTCTGTACCAA TTAATTGCATAAGGCCCTATAACAATACAAGACAAAGTACACGTATA---------GGACCAGGGCAAGC ACTCTTTACA---ACA---AAA------GTAATAGGAGATATA---AGACAAGCACATTGTAACATTAGT GGAGCAGGATGGAATAAAACTTTACAACAGGTAGCTGAAAAATTAGGAAAC---------CTTCTTAACC AG---------ACAACA ; E-CM240 ATAATCAGATCTGAAGATCTCACAAACAATGCCAAAACCATAATAGTGCACCTTAATAAATCTGTAGAAA TCAATTGTACCAGACCCTCCAACAATACAAGAACAAGTATAACTATA---------GGACCAGGACGAGT ATTCTATAGA---ACAGGAGAT------ATAATAGGAAATATA---AGAAAAGCATATTGTGAGATTAAT GGAACAAAATGGAATAAAGTTTTAAAACAGGTAACTGAAAAATTAAAAGAG---------CACTTTAAT- -----------AAGACA ; E-TN235 ATAATCAGATCTGAAAATCTCACAAACAATGCCAAAACCATAATAGTGCACCTTAATAAATCTGTAGAAA TCAATTGTACCAGACCCTCCAACAATACAAGAACAAGTATACCTATA---------GGTCCAGGACAAGC ATTCTATAGA---ACAGGAGAC------ATAATAGGAGATATA---AGAAAAGCATATTGTGAGATTAAT GGAACAAAATGGAATGAAGTTTTAACACAGGTAACTGAAAAATTAAAAGAG---------CACTTTAATA AT---------AAGACA ; E-90CR402.1 ATAATCAGATCTGAAGATCTCACAGACAATGCCAAAACCATAATAGTGCACCTTAATAAATCTATAGAAA TCAATTGTACCAGACCCTTCAAGAAAGTAAGAATAAGTGCAAGGATA---------GGACCAGGACGAGT ATTCCATACA---ACAGGAAAC------ATAAATGGTGATATA---AGAAAAGCATATTGTGAAATTAAT AAAACAAAATGGAAAGAAACTTTAAAACAGGTAACAAGAAAATTAAGAGAG---------CACCTTAATG GG------ACAATGACA ; E-93TH253.3 ATAATCAGATCTGAAAATCTCACAAACAATGCCAAAACCATAATAGTGCACCTTCATGAATCTGTAGAAA TCAATTGTACCAGACCCTTCTACAATAAAAGAACAAGGACATCTATA---------GGACAAGGACGAGT ACTCTATAGA---ACAGGAGAC------ATAACAGGAAATATA---GGAAAACCATATTGTGAGATTAAT GGAACAAAATGGAATAAAGTTTTAAATCAGGTAACTGAAAAATTAAAAGAG---------CACTTTAATA AT---------AGGAAC ; F-93BR020.1 GTAATCAGATCTCAAAATATCTCAGATAATGCAAAAACCATAATAGTGCACCTTAATGAATCTGTACAGA TTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATATCTTTA---------GGACCAGGACGAGT ATTTTATACA---ACAGGAGAA------ATAATAGGAGACATC---AGAAAGGCACATTGTAACGTTAGT GGAACACAATGGAGGAACACGTTAGCAAAGGTAAAGGCAAAGTTAGGGTCT---------TATTTCCCTA AT---------GCAACA ; F-BZ163A ATAATCAGATCTCAAAATATCTCAGATAATGCAAAAACCATAATAGTACACTTTAATGAATCTGTACAGA TTAATTGTACAAGACCCAACAACAATACAAGAAAAGGTATACATATA---------GGACCAGGACGAGC ATTTTATGCA---ACAGGAGAC------ATAATAGGAGACATC---AGAAAGGCCCATTGTAATGTTAGT GGAACACAATGGAATAAAACATTAGAACAAGTAAGGGCAAAGTTAAAGTCT---------CATTTTCCTA AT---------GCAACA ; F-BZ126A ATAATCAGATCCCAAAATATCTCAGATAATGCAAAAACCATAATAGTACACTTTAATGAATCTGTACAGA TTAATTGTACAAGACCCAACAACTATACAAGAAAAAGTATATATTTT---------GGACCAGGACGAGC ATTTCATACA---GCAGGAAAA------ATAATAGGAGACATC---AGAAAGGCCCATTGTAACGTTAGT GGAACACAATGGAATAAAACATTAGAACGGGTAAGGGCAAAGTTAAAGTCT---------CATTTCCCTA AT---------ACAACA ; G-92NG003.1(g3) GTAATTAGATCTGAAAACCTCACAGACAATGCCAAAGTCATAATAGTACAGCTTAATAAAACTATAGGAA TTAATTGTACCAGACCCAACAACAATACAAGAAAAAGTATAAGAATC---------GGACCTGGACAAGC GTTCTATGCA---ACAGGTGAA---------ATA------ATA---GGACAAGAA--------------- ---------TGGCAGGAGATGTTACAGAAGGTACAGGCACAACTAGAACAG---------GTCTTTAAC- -----------AAAAGT ; G-92NG083.2(jv10832 AGAATTAGATCTGAAAATTTCACAGACAATACCAAAGTCATAATAGTGCAGCTTAATAATAGTATAGAAA TTAATTGTATCAGACCCAATAACAATACAAGAAAAAGTATACCAATC---------GGACCAGGACAAGC GTTCTATGCA---ACAGGTGAT------ATAATAGGAGACATA---AGACAAGCACATTGTAATGTTAGT AGAATAAAATGGAGGGAGATGTTAAAGAATGTCACAGCACAGCTAAGGAAA---------ATCTATAATA AT---------AAGAAC ; G-92UG975.10 ATGATTAGATCTAAAAACCTTACAGATAATGCCAAAGTCATAATAGTGCAGCTTAATGAAACTGTAGAAA TTATATGCACCAGACCCAACAACAATACAAGGAAAAGTATAAACTTA---------GGGCCAGGACAAGC AATCTATGCA---ACAGGGGCC------ATAATAGGAGATATA---AGACAGGCACATTGTAATGTTAGT GGAGGAAATTGGAGTACAATGCTACAGAGGGTAAAAGCACAACTAGCAAGA---------ACCTTTAAC- -----------AAGAAC ; G-92RU131.9 ATAGTTAGATCTGAAAACTTCACAGACAATGCCAAAGTCATAATAGTGCAGCTTAATAAATCTGTAGAAA TTACATGTACCAGACCTAATAACAATACAAGAAAAAGTATAACTTTT---------GCACCAGGACAAGC GCTCTATGCA---ACAGGTGAA------ATAATAGGAGATATA---AGACAAGCACATTGTAATGTTAGT AGAAAAGATTGGAATGAGATGTTGCAGAATGTGACTACAAAACTAAAAGGA---------ATCTTTAAC- -----------AACACA ; H-90CR056.1(u40561) ATAATTAGAACTAAAAATATCTCAGACAATACCAAAAACATAATAGTACAGCTTAAGACACCAGTAAACA TTACATGTACCAGGCCTAACAATAATACGAGAACAAGTATACATTTA---------GGGCCAGGACGAGC ATTCTATGCA---ACAGGTGAC------ATCATAGGAGATATA---AGACAAGCACATTGTAATATTAGT AGAACAGACTGGAATAAGACTTTACACCAGGTAGTTACACAATTAGGAATA---------CACTTGAACA AT---------AGAACA ; H-VI557 ATAATTAGATCTAAAAATATCACAGACAATACCAAAAACATAATAGTACAGCTTAAAAGTCCTGTACCAA TTAACTGTACCAGACCCAACAATAATACGAGAAAAAGTATAAGTATA---------GGGCCAGGACAAGC ATTCTATGCA---ACAGGTGAC------ATCATAGGAGATATA---AGAAAAGCATATTGTAATATTACT AGGGAAGATTGGAAAAGGACTTTACATGAGGTAGTTCAGCAATTAAGAGAA---------CACTTTAAT- -----------AATCAA ; H-CA13 ATGATCAGATCTGAAAATATCACAGACAATACCAAAAACATAATAGTACAGCTTAAAAATCCTGTAGTAA TTAACTGTACCAGACCCAACAATAACACGAGAAGAAGTATGCGTATA---------GGTATAGGACGAGG ACAAACATTC---CATGCAATAGGTGCTATAATAGGAGATATA---AGACAAGCACATTGTAATATTAGT GGAGCAAAGTGGAATGACATGTTAACCAAGGTAGCTACACAATTAGGAAAA---------CACCTGAAC- -----------AAGAGC ; J-SE7022 ATAATTAGATCTGAAAATATCTCAGACAATGCYAAAAACATAATAGTACAACTTAATGAYACTGTAAAAA TTGTGTGTACCAGACCCTATAACAACACAAGGGAAAGTATACACATG---------GGACCAGGACAAGT GCTCTACGCA---ACAGGGGAA------ATAATAGGAAATATA---AGAGAAGCACATTGTAACATTAGT GRAAGAGATTGGAATAACACTTTACGTAGAGTAGCTACAAAACTAAGAGAA---------YACTTTAAT- -----------AAAACA ; J-SE7887 ATAATTAGATCTGAAAATATCTCAGACAATGCCAAAAACATAATAGTACAACTTAATAAAACTGTAGAAA TTGTRTGTAACAGACCTAATAACAACACAAGRAAAGGTATACACATG---------GGACCAGGACAAGT GCTCTACGCA---ACAGGGGAA------ATAATAGGAAATATA---AGAGAAGCACATTGTAACATTAGT GAAAGAGATTGGAATAACACTTTACGTAGAGTAGCTACAAAACTAAGAGAA---------CACTTTAAT- -----------AAAACA ; O-MVP5180 AGAATTATGGGAAAAAATATTACAGAATCAGCAAAGAATATCATAGTAACCCTAAACACTCCTATAAACA TGACCTGCATAAGAGAAGGAATTGCAGAGGTACAAGATATATATACA---------GGTCCAATGAGATG GCGCAGTATGACACTTAAAAGAAGTAACAATACATCACCAAGATCAAGGGTAGCTTATTGTACATATAAT AAGACTGTATGGGAAAATGCCCTACAACAAACAGCTATAAGGTATTTAAATCTTGTAAACCAAACAGAGA AT---------GTTACC ; O-ANT70 AGAATGATGGCAAAAGATATTTTGGAAGGTGGAAAAAATATCATAGTGACCCTAAACTCTACCCTAAACA TGACCTGTGAAAGACCACAAATAGAC---ATACAAGAGATGAGAATA---------GGTCCAATGGCCTG GTACAGCATGGGAATAGGGGGAACA---GCAGGAAACAGCTCA---AGGGCAGCTTATTGCAAGTATAAT GCCACTGATTGGGGAAAAATATTAAAACAAACAGCTGAAAGGTATTTAGAA---------CTAGTAAACA ATACAGGTAGTATTAAC ; CPZANT GTAATG---AATGGTCGCAAAAATGAATCTGTGCTTGTAAGATTTGGAAAAGAATTCGAAAACTTAACAA TTACATGTATAAGACCAGGAAATAGGACAGTAAGAAATCTACAAATA---------GGACCAGGAATGAC TTTCTATAAC---GTAGAAATAGCA------ACAGGAGACACT---AGGAAAGCGTTCTGTACAGTCAAT AAGACGCTATGGGAACAAGCACGTAACAAAACAGAGCACGTTCTTGCGGAG---------CATTGGAAAA AA------GTAGACAAC ; CPZGAB ACTGTAAGAGTGGAGAATAAGTCAAAAAATACTGATGTCTGGATAGTACAGCTAGTAGAAGCAGTTAGTC TAAATTGTCATAGACCAGGAAACAATACAAGGGGAGAGGTGCAGATA---------GGGCCAGGAATGAC CTTTTATAAT---ATAGAAAATGTA------GTAGGAGATACC---AGATCTGCCTACTGTAAGATAAAT GGGACCACATGGAATCGAACGGTGGAAGAAGTAAAAAAGGCTTTAGCAACC---------TCATCAAATC GA------ACAGCAGCC
last modified: Fri Aug 10 14:02 2007


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health