HIV Databases HIV Databases home HIV Databases home
HIV sequence database



; A-U455 TTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCAGGGAATTTTCCTCAGAGCAG------ACCA GAGCCAACAGCCCCACC---------------------------------AGCAGAAATCTTTGGGATGG GGGAAAAGAT---------------GACCTCCCCTGCGAAACAGGAGCT---GAAAGACAGGGAACA--- GACTCCTTTAGTTTCCCTCAAATCACTCTTTGGCAACGACCCCTTGTCACAGTAAAAATAGGAGGACAGC TGATAGAAGCTCTATTAGATACAGGAGCAGATGATACAGTCTTAGAAGACATAAATTTGCCAGGAAAATG GAAACCAAAAATAATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTTATAGAA ATTTGTGGAAAAAAGACTATAGGTACAGTATTGGTAGGACCTACACCTGTCAACATAATTGGAAGGAATA TGTTGACTCAGATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAA ACCAGAAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAACAGAA ATTTGTAATGAGATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAG TATTTGCTATAAAGAAAAAGGACAGCACTAAATGGAGGAAATTAGTAGATTTCAGAGAACTCAATAAAAG AACTCAGGACTTCTGGGAAGTTCAATTAGGAATCCCGCATACAGCGGGTCTAAAAAAGAAAAAATCAGTA ACAGTACTAGATGTGGGGGACGCATATTTTTCAGTTCCTTTAGATGAAAGCTTTAGAAAGTATACTGCGT TCACCATACCTAGTATAAACAATGAGACACCAGGAGTCAGGTATCAGTACAATGTGCTTCCGCAGGGATG GAAAGGATCACCATCAATATTCCAGAGTAGCATGACAAAAATCTTAGAGCCCTTTAGATCACAACATCCA GACATAGTTATCTATCAATACATGGATGACTTGTATGTGGGATCTGATTTAGAAATAGGGCAACATAGAG CAAAAATAGAGGAATTAAGAGCTCATCTATTGAGCTGGGGATTCATTACCCCAGACAAAAAGCATCAGAA AGAACCTCCATTTCTTTGGATGGGGTATGAACTTCATCCTGACAAATGGACAGTTCAGCCTATACAGCTG CCAGAAAAAGACAGCTGGACTGTCAATGATATACAGAAATTAGTAGGAAAACTAAATTGGGCAAGTCAGA TTTATGCAGGGATTAAAGTAAAGCAACTGTGTAAACTTCTCAGGGGAGCCAAAGCACTAACAGATATAGT AACCCTGACTGAAGAAGCAGAATTAGAATTGGCAGAGAACAGGGAGATTCTAAAAGACCCTGTGCATGGA GTATATTATGACCCATCAAAAGACCTAGTAGCAGAAATACAGAAACAAGGGCAAGACCAATGGACATATC AAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAAAAAGGTCTGCTCACACTAA TGATGTAAAACAATTAACAGAAGTGGTGCAAAAAGTGTCCACAGAAAGCATAGTAATATGGGGAAAGATC CCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAGCATGGTGGATGGAGTATTGGCAGGCTACCT GGATTCCTGAATGGGAGTTTGTCAATACCCCTCCCCTAGTAAAATTATGGTACCAGTTAGAGAAAGACCC CATAGCAGGAGCAGAGACATTCTATGTAGATGGGGCAGCTAATAGGGAAACTAAGCTAGGAAAAGCAGGG TATGTCACTGACAGAGGAAGACAAAAGGTTGTTTCCCTAACTGAGACAACAAATCAAAAGACTGAATTAC ATGCAATCCATCTAGCCTTGCAGGATTCAGGATCAGAAGTAAATATAGTAACAGACTCACAGTATGCATT AGGGATCATTCAGGCACAACCAGACAGGAGTGAATCAGAAATAGTCAATCAAATAATAGAGAAGCTAATA GAAAAGGAAAAAGTCTACCTGTCATGGGTACCAGCGCACAAAGGGATTGGAGGAAATGAGCAAGTAGATA AATTAGTCAGTTCTGGAATCAGGAAGGTGCTATTTTTAGATGGGATAGATAAGGCTCAAGAGGACCATGA AAAATATCACTGCAACTGGAGAGCAATGGCTAGTGATTTTAATCTGCCACCTGTGGTAGCGAAGGAAATA GTAGCCAGCTGTAATAAATGTCAACTAAAAGGGGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGGA TATGGCAATTAGATTGCACACATCTAGAAGGAAAAGTAATCCTAGTAGCAGTCCATGTAGCCAGTGGCTA CATAGAAGCAGAAGTTATCCCAGCAGAAACAGGACAGGAGACAGCATACTTTATACTAAAATTAGCAGGA AGATGGCCAGTAAAAGTAATACACACAGACAATGGCAGCAATTTCACCAGCGCTGCAGTTAAAGCAGTCT GTTGGTGGGCAAATATCCAACAGGAATTTGGGATCCCCTACAATCCCCAAAGTCAAGGAGTAGTGGAATC CATGAACAAGGAATTAAAGAAAATCATAGGGCAGGTAAGAGAGCAAGCTGAACACCTTAAGACAGCAGTA CAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAA TAATAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTTCAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAGACCCCATTTGGAAAGGACCAGCAAAACTACTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGACAATAGTGATATAAAGGTAGTACCAAGAAGAAAAGCAAAGATCATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTATGGCAGGTAGACAGGATGAAGAT-------------- ----------------TAG ; A-92UG037.1 TTTTTTAGGGAAAATCTGGCCTTCCAGCAAAGGGAGGCCAGGAAATTTTCCTCAGAGCAG------ACCA GAACCAACAGCCCCACCAGC------------------------------AGCAGAGATCTTTGGGATGA GGGAAGAGAT---------------AGTCTCCCCTCCGAAGCAGGAGCA---GAACGACAGGGACCAGAA CCCACCTTCAGTTTCCCTCAAATCACTCTTTGGCAACGACCTCTTGTCACAGTAAAGATAGGGGGACAGC TAAAAAAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATAAATTTGCCAGGAAAATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTCATCAAGGTAAAGCAGTATGATCAGATACTTATAGAA ATTTGTGGAAAAAAGGCTATAGGTACAGTATTGGTAGGACCTACACCTGTCAACATAATTGGAAGAAATA TGTTGACCCTGATTGGTTGTACTTTAAATTTCCCAATTAGTCCTATTAGTACTGTACCAGTAAAATTAAA ACCAGGAATGGATGGCCCAAGGATTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAA ATTTGTGCAGATATGGAAAGAGAAGGAAGAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAA TATTTGCTATAAAGAAAAAGGACAGCACTAAATGGAGAAAATTAGTAGATTTTAGAGAGCTCAATAAAAG AACTCAAGACTTTTGGGAAGTTCAATTAGGAATACCGCATCCAGCGGGCTTAAAAAAGAAAAAATCAGTA ACAGTACTAGATGTGGGGGACGCATATTTTTCAGTTCCCTTAGATGAAAGCTTTAGAAAGTATACTGCAT TCACCATACCTAGTACAAACAATGAGACACCAGGAATCAGGTATCAGTACAATGTGCTTCCACAGGGATG GAAAGGATCACCGGCAATATTCCAGGCCAGCATGACAAAAATCTTAGAGCCCTTTAGATCAAAAAATCCA GACATAGTTATCTATCAATACATGGATGACTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAA CAAAAATAGAAGAATTAAGAGAACATCTATTAAAATGGGGATTTACTACACCAGACAAAAAGCATCAGAA AGAACCTCCATTTCTTTGGATGGGATATGAACTCCATCCTGATAAGTGGACAGTCCAACCGATAGAGCTG CCAGAAAAGGAAAGCTGGACTGTCAATGATATACAGAAATTAGTAGGGAAACTAAATTGGGCAAGTCAAA TTTATGCAGGAATTAAAGTAAAACAATTGTGTAAACTCCTCAGGGGAACCAAAGCATTAACAGATATAGT AACATTGACTGAGGAAGCAGAATTAGAATTGGCAGAGAACAGGGAGATTTTAAAAGACCCTGTGCATGGA GCATATTATGACCCATCAAAAGACTTAATAGCAGAGATACAGAAACAAGGGCAAGACCAATGGATATATC AAATTTATCAAGAGCCATTTAAAAATCTAAAAACAGGAAAATATGCAAGAAAAAGGTCTGCTCACACTAA TGATGTAAAACAATTGGCAGAAGTGGTGCAAAAGGTGGTCATGGAAAGCATAGTAATATGGGGAAAGACT CCTAAATTTAAACTACCCATACAAAAAGAAACATGGGAAACATGGTGGATGGACTATTGGCAGGCTACCT GAATTCCTGAATGGGAGTTTGTCAATACCCCTCCTCTAGTAAAATTATGGTACCAGTTAGAGAAAGACCC CATAGCAGGAGCAGAGACTTTCTATGTAGATGGGGCAGCCAATAGGGAGACTAAGCTAGGAAAAGCAGGG TATGTCACTGACAGAGGAAGGCAAAAGGTTGTTTCCCTAACTGAGACAACAAATCAAAAGACTGAATTAC ATGCAATCCATCTAGCCTTGCAGGATTCAGGATCAGAAGTAAACATAGTAACAGACTCACAGTATGCATT AGGAATCATTCAGGCCCAGCCAGACAGGAGTGAATCAGAGTTAGTCAATCAAATAATAGAGAAGCTAATA GAAAAGGACAAAGTCTACCTGTCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATA AATTAGTCAGTTCTGGAATCAGGAAGGTACTATTTTTAGATGGGATAGATAAAGCTCAAGAAGAACATGA AAGATATCACAGCAATTGGAGAGCAATGGCTAGTGATTTTAATCTGCCACCTATAGTAGCAAAGGAAATA GTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATGCATGGACAAGTAGACTGTAGCCCAGGGA TATGGCAATTAGATTGTACACATCTAGAAGGAAAAGTAATTCTGGTAGCAGTCCATGTGGCTAGTGGCTA CGTAGAAGCAGAAGTTATTCCAGCAGAAACAGGACAGGAGACAGCATACTTTCTACTAAAGCTAGCAGGA AGATGGCCAGTAAAAGTAGTACACACAGACAATGGCAGCAATTTCACCAGCGCTGCGGTTAAAGCAGCCT GTTGGTGGGCAAATGTTAAACAGGAATTTGGTATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAGGAATTAAAGAAAATCATAGGGCAGGTAAGGGAGCAAGCTGAACATCTTAAGACAGCAGTA CAAATGGCAGTGTTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAATAGACATAATAGCATCAGACTTACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAAATT TCGGGTTTGTTACAGGGACAGCAGAGATCCAATTTGGAAAGGACCAGCAAAACTACTCTGGAAAGGTGAA GGGGCAGTGGTAATACAGGACAATAGTGATATAAAAGTAGTACCAAGAAGAAAAGTAAAGATCATTAAGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAGGAT-------------- ----------------TAG ; B-HXB2 TTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAG------ACCA GAGCCAACAGCCCCACC---------------------------------AGAAGAGAGCTTCAGGTCTG GGGTAGAGACAAC------------AACTCCCCCTCAGAAGCAGGAGCC---GATAGACAAGGAACT--- GTATCCTTTAACTTCCCTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAAC TAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAA ATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATC TGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAA ATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAG TATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAG AACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTA ACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCAT TTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATG GAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCA GACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAA CAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAA AGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTG CCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGA TTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAAT ACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGA GTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATC AAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAA TGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACT CCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCT GGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACC CATAGTAGGAGCAGAAACCTTCTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGA TATGTTACTAATAGAGGAAGACAAAAAGTTGTCACCCTAACTGACACAACAAATCAGAAGACTGAGTTAC AAGCAATTTATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATT AGGAATCATTCAAGCACAACCAGATCAAAGTGAATCAGAGTTAGTCAATCAAATAATAGAGCAGTTAATA AAAAAGGAAAAGGTCTATCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATA AATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGATGAACATGA GAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATA GTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAA TATGGCAACTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATA TATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTTAAAATTAGCAGGA AGATGGCCAGTAAAAACAATACATACTGACAATGGCAGCAATTTCACCGGTGCTACGGTTAGGGCCGCCT GTTGGTGGGCGGGAATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTA CAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAAATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGAT-------------- ----------------TAG ; B-JRFL TTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAG------ACCA GAGCCAACAGCCCCACC---------------------------------AGAAAAGAGCTTCAGGTTTG GGGAAGAGAC------------AGCAACTCCCTCTCAGAAGCAGGAGCC---GATAGACAAGGAAAT--- GTATCCTTTAACTTCCCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAAC TAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACATGGATTTGCCAGGAAGATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAATATGATCAGATACTCATAGAA ATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATC TGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAAGTCAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAA ATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAG TATTTGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAA AACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAGAAAATCAGTA ACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGGAAATATACTGCAT TTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGGTATCAGTACAATGTGCTTCCGCAGGGATG GAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCA GACATAATTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAGATAGGGCAGCATAGAG CAAAAATAGAGGAATTGAGACAACATCTGTTGAGGTGGGGGTTTACCACACCAGACAAAAAACATCAGAA AGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGACAAATGGACAGTACAGCCTATAGTGCTG CCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGTCAGA TTTACGCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAAT ACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGGGAGATTCTAAAAGAGCCAGTACATGGA GTGTATTATGACCCATCAAAAGACTTAATAGCAGAACTACAGAAGCAGGGGCAAGGCCAATGGACATATC AAATTTATCAAGAGCCATTTAAAATTCTGAAAACAGGAAAATATGCAAGAACGAGGGGTGCCCACACTAA TGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCAATGAAAGCATAGTAATATGGGGAAAGATT CCTAAATTTAAATTACCCATACAAAAAGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCT GGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACC CATAGTAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAACAGGGAGACTAAACTAGGAAAAGCAGGA TATGTTACTAATAGAGGAAGACAAAAAGTTGTCTCCCTAACTGACACAACAAATCAGAAAACTGAGTTAC AAGCAATTCATCTAGCGTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATT AGGAATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTCAGTCAAATAATAGAGCAGTTAATA AAAAAGGAAAAAGTCTACCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATA AATTAGTCAGTGCTGGAATCAGGAAAGTGCTATTTTTAGATGGAATAGATAAGGCCCAAGAAGATCATGA GAAATATCACAGTAATTGGAAAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATA GTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGATTGTAGTCCAGGAA TATGGCAACTAGATTGTACACATTTAGAAGGAAAAATTATCCTGGTAGCAGTTCATGTAGCCAGTGGATA TATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATACTTTCTCTTAAAATTAGCAGGA AGATGGCCAGTAAAAACAATACATACAGACAATGGCAGCAATTTCACCAGTACTACGGTTAAGGCCGCCT GTTGGTGGGCTGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTA CAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAGAGCCACTTTGGAAAGGACCAGCAAAGCTTCTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGATAATAGTGATATAAAAGTAGTGCCAAGAAGAAAAGTAAAGATCATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGAT-------------- ----------------TAG ; B-OYI TTTTTTAGGGAAGATCTGGCCTTCCCACAAGGGAAGGCCAGGGAATTTTCTTCAGAACAG------ACCA GAGCCAACAGCCCCACC---------------------------------AGCAGAGAGCTTCGGGTTTG GGGAAGAGACAAC------------AACTCCCCCTCAGAAGCAGGAGCC---GATAGACAAGGGACT--- GTATCCTTTAACCTCCCTCAGATCACTCTTTGGCAACGACCCATCGTCACAATAAAGATAGGGGGGCAAC TAAAAGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAGATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAA ATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATC TGTTGACTCAGCTTGGTTGTACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAGAAAATAAAAGTATTAATAGAA ATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAGTTGGGCCTGAAAATCCATACAATACTCCAG TATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAG AACTCAGGACTTCTGGGAAGTCCAATTAGGAATACCACATCCAGCAGGGTTAAAAAAGAAAAAATCAGTA ACAGTACTGGATGTGGGTGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTCAGAAAGTATACTGCAT TTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATG GAAAGGATCACCAGCGATATTCCAAAGTAGTATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCA GACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAA CAAAAATAGAGGAACTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAGAA AGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAATGCTG CCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGTCAGA TTTATGCAGGGATTAAAGTAAAGAACTTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAAT ACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGGGAGATTCTAAAAGAACCAGTACATGGA GTGTATTATGACCCATCAAAAGACTTAGTAGCAGAATTACAGAAACAGGGACAAGGCCAATGGACATATC AAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAA TGATGTAAAACAGTTAACAGAGGCAGTGCAAAAAATAACCCAAGAAAGCATAGTAATATGGGGAAAGACT CCTAAATTTAAACTACCCATACAAAAAGAAACATGGGAAGCATGGTGGACGGAGTATTGGCAAGCCACCT GGATTCCTGAATGGGAGTTTGTCAATACCCCTCCCTTAGTAAAATTATGGTACCAGTTAGAGAAAGACCC CATAGTAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGGGAGACTAAATTAGGAAAAGCAGGA TATGTTACTGACAGAGGAAGACAGAAAGTTGTCTCCCTAACTGACACAACAAATCAGAAGACTGAATTAC AAGCAATTCATCTAGCTCTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATT AGGAATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTCAGTCAAATAATAGAGCAGTTAATA AAAAAGGAAAAGGTCTACCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATA AATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTGGATGGAATAGATAAGGCCCAAGAGGAACATGA GAAATATCACAGTAACTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATA GTAGCCAGCTGTGATAAATGCCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAA TATGGCAACTAGATTGTACACATTTAGAAGGAAAAATTATCCTGGTAGCAGTTCATGTAGCCAGTGGATA TATAGAAGCAGAAGTTATTCCAGCAGAGACAGGGCAGGAAACAGCATACTTTATCTTAAAATTAGCAGGA AGATGGCCAGTAAAAACAATACATACAGACAATGGCAGCAATTTCACCAGTACTACGGTTAAGGCCGCCT GTTGGTGGGCAGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAATGAATTAAAGAAAATTATAGGACAAGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTA CAAATGGCAGTATTTATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAGTAGATATAATAGCTACAGACATACAAACTAAAGAACTACAAAAACAAATTACAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAGAACCACTTTGGAAAGGACCAGCAAAGCTTCTTTGGAAAGGTGAA GGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGGAAAGCAAAGATCATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGAT-------------- ----------------TAG ; B-RF TTTTTTAGGGAAAATCTGGCCTTCCCACAAGGGAAGGCCAGGGAACTTTCTTCAGAGCAG------ACCA GAGCCAACAGCCCCACC---------------------------------AGAAGAGAGCTTCAGGTTTG GGGAAGAGAC---------------AACTCCCTCTCAGAAGCAGGAGAA---GATAGACAAGGAACT--- GTATCCTTTAGCTTCCCTCAAATCACTCTTTGGCAACGACCCATCGTCACAGTAAAGATAGGGGGGCAAT TAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAAATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTGAGACAGTATGATCAAATACTCATAGAA ATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATC TGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAGGAAAAAATAAAAGCATTGGTAGAA ATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCCAAAATTGGGCCTGAAAATCCATACAATACTCCAG TATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAG AACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCTGCAGGGTTAAAAAAGAAGAAATCAGTA ACAGTATTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGAGTTCAGGAAGTATACTGCAT TTACCATACCTAGTATAAACAATGAAACACCACGGATTAGATATCAGTACAATGTGCTTCCACAAGGGTG GAAAGGATCACCAGCAATATTCCAAAGTAGTATGACAAAAATCTTAGAGCCTTTTAAAAAACAAAATCCA GAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAA TAAAAATAGAGGAACTGAGAGAACATCTGTTAAAGTGGGGGTTTACCACACCGGACAAGAAACATCAGAA AGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTG CCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTGAATTGGGCAAGTCAGA TTTATGCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAGT ACAACTAACAAAAGAAGCAGAGCTAGAACTGGCAGAAAATAGGGAGATTCTAAAAGAACCAGTACATGGA GTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATACC AAATTTATCAAGAGCCATTTAAAAACCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAA TGATGTAAAACAATTAACAGAGGCAGTACAAAAAGTAGCCACAGAAAGCATAGTAATATGGGGAAAGACT CCTAAATTTAAACTACCCATACAAAAAGAAACATGGGAGGCATGGTGGACAGAGTATTGGCAAGCCACCT GGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTAAAATTGTGGTACCAGTTAGAAAAAGAACC CATAATAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGAGAGACTAAATTAGGAAAAGCAGGA TATGTTACTGACAGAGGAAGACAAAAAGTTGTCTCCCTAACTGACACAACAAATCAGAAGACTGAGTTAC AAGCAATTCATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATT GGGAATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTCAGTCAGATAATAGAGCAGTTAATA AAAAAGGAAAAGGTCTACCTGGCATGGGTACCAGCACACAAAGGGATTGGAGGAAATGAACAAGTAGATA GATTAGTCAGTACTGGAATCAGGAAAGTACTATTTTTGGATGGAATAGATAAGGCCCAAGATGAACATGA GAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATA GTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGATTGTAGTCCAGGAA TATGGCAACTAGATTGTACACATCTAGAAGGAAAAATTATCCTGGTAGCAGTTCATGTAGCCAGTGGCTA TATAGAAGCAGAAGTTATTCCAGCAGAAACAGGACAGGAAACAGCATACTTTATCTTAAAATTAGCAGGA AGATGGCCAGTAAAAGTAATACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT GTTGGTGGGCAGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAACAATTAAAGCAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTA CAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAGTAGACATAATAGCAACAGACATACAAACTAAAGAACTACAAAAACAAATTACAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAGATCCACTTTGGAAAGGACACGCAAAGCTTCTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGAT-------------- ----------------TAG ; C-ETH2220 TTTTTTAGGGAGACTTTGGCCTTCCAACAAGGGAAGGCCAGGGAATTTCCTTCAGAGCAG------ACCA GAGCCAACAGCCCCACCAGAGAGTCTCAGACCAGAGCCAACAGCCCCACCACCAGAGAGCTTCAGGTTCG AGGAAGCAAC------------------ACCTTCTCCGAAGCAGGAGCT---GAAAGACAGGGA------ ---AGCCTTAACTTCCCTCAAATCACTCTTTGGCAACGACCACTTGTTACAATAAAAATAGGGGGACAGC TAAAGGAGGCTCTCTTAGACACAGGAGCAGATGATACAGTATTAGAAGAAATAAATTTGCCAGGAAAATG GAAACCAAAAATGATAGGAGGAATTGGAGGTTTTATTAAAGTAAGACAGTATGATCAAATAATCATAGAA ATTTGTGGAAAAAAGGCTATAGGTACAGTACTAGTAGGACCTACACCTGTCAACATAATTGGCAGAAACA TGTTGACTCAGCTTGGACGCACATTAAACTTTCCAATTAGTCCCATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAAGTCAAACAATGGCCATTGACAGAAGAAAAGATAAAAGCATTAACAGCA ATTTGTGAAGAAATGGAGCAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAACCCATATAATACTCCAG TATTTGCCATAAAAAAGAAGGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGGGAACTCAATAAAAG AACTCAAGACTTTTGGGAAGTTCAATTAGGGATACCACACCCAGCAGGGTTAAAAAAGAAAAAATCAGTG ACAGTACTAGATGTGGGGGATGCATATTTCTCAGTTCCTTTAGATGAAGGTTTCAGAAAATATACTGCAT TCACCATACCTAGTACAAACAATGAAACACCAGGGATTAGATATCAATATAATGTCCTCCCACAGGGATG GAAAGGATCACCACCAATATTCCAGAGTAGCATGCCCCAAATCTTAGAGCCCTTTAGGGCCCCCAACCCA GAAATAGTTATCTATCAATATATGGATGACTTGTATGTAGGATCTGACTTAGAAATAGGGCAACATAGAG CCCCAATAGAAGAGTTAAGAGAACATCTATTAAAGTGGGGATTTACCACACCAGACAAGAAACATCAGAA AGAACCTCCATTTCTTTGGATGGGGTATGAACTTCATCCTGACAAATGGACAGTACAGCCTATACAGCTG CCAGAAAAGGATAGCTGGACTGTCAATGATATACAAAAGTTAGTGGGAAAATTAAACTGGGCAAGTCAGA TTTACCCAGGGATTAAAGTAAGGCAACTGTGTAAACTCCTTAGGGGAGCCAAAGCACTAACAGACATAGT AACACTAACTGAAGAAGCAGAATTAGAATTGGCAGAGAACAGGGAAATTCTAAAGGAACCAGTACATGGA GTATTTTATGACCCATCAAAAGACTTAATAGCTGAAATACAGAAACAGGGGAATGACCAATGGACATTTC AATTTTACCAAGAACCATTCAAAAATCTGAAAACAGGGAAGTTTGCAAAAAGAGGGACTGCCCACACTAA TGATGTAAAGCAGTTAACAGCGGTAGTGCAAAAGATAGCCCTGGAAAGCATAGTAATATGGGGAAAGACT CCTAAATTTAGATTACCCATCCAGAAAGAAACATGGGAAGCATGGTGGACAGACTATTGGCAAGCCACCT GGATTCCTGAATGGGAGTTTGTTAATACCCCTCCCCTAGTAAAATTATGGTACCAGCTAGAGAAAGAACC CATAGCAGGAGTAGAAACTTTCTATGTAGATGGAGCAGCTAATAGGGAAACTAAAATAGGAAAAGCAGGG TATGTTACTGATAGAGGAAGGCAGAAAATTGTTTCTCTAACTGAAACAACAAATCAGAAGACTGAATTAC AAGCGATCCAGCTAGCGTTACAGGATTCAGGATCAGAAGTAAACATAGTAACAGACTCACAGTATGCATT AGGGATCATCCTGGCACAACCAGATAAGAGTGAATCAGAGATAGTCAATCAAATAATAGAACAGTTAATA AGCAAGGAAAGGGTCTACCTGTCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATA AATTAGTAAGTAGTGGAATCAGGAAAGTGCTGTTTCTAGATGGAATAGATAAGGCTCAAGAAGAGCATGA AAAATATCACAGCAATTGGAGAGCAATGGCTAATGAATTTAATATCCCACCCGTAGTACCCAAAGAAATA GTAGCTTGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATACATGGACAAGTAAATTGTAGTCCAGGGA TATGGCAATTAGATTGTACACACTTAGAAGGGAAAATCATCCTGGTAGCAGTCCATGTAGCCAGTGGCTA CATAGAGGCAGAGGTTATTCCAGCAGAAACAGGACAAGAAACAGCATACTTTCTACTAAAATTAGCAGGG AGATGGCCAGTCAGGGTAATACATACAGATAATGGCAGTAACTTCACCAGTAATGCAGTTAAAGCAGCCT GTTGGTGGGCAGGTATTCAACAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAAGAATTAAAGAAAATCATAGGGCAGGTAAGAGAACAAGCTGAGCACCTTAAGACAGCAGTA CAAATGGCAGTATTCATTCACAATTTTAAAAGAAGAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAATAGATATAATAGCATCAGACATACAGACTAAAGAACTCCAAAACCAAATTTTAAAAATTCAAAATTT TCGGGTTTATTACAGAGACAGCAGAGACCCTATTTGGAAAGGACCAGCCAAACTACTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGATAATAGTGACATAAAGGTAGTACCAAGGAGGAAAGCAAAAATCATTAGGG ATTATGGAAAACAGATGGCAGGTGCTGATTGTGTGGCAGGTAGACAGGATGAAGAT-------------- ----------------TAG ; C-92BR025.8 TTTTTTAGGGAAAATTTGGCCTTCCCACAGGGGGAGGCCAGGAAATCTTCTTCAGAACAG------AACA GAGCCAACAGCCCCACC---------------------------------AGAAGAGAGCTTCAGGTTTG GGGAAGAGACAAC------------AACTCCCTCTCGGAAGCAGGAGAC---GATAGACAAGGAACT--- ---GCCCTTAACTTCCCTCAAATCACTCTTTGGCAGCGACCCCTTGTCAACATAAAAGTAGGGGGACAGC TAAAGGAGGCTCTCTTAGACACAGGAGCAGATGATACAGTATTAGAAGAAATAAAATTGCCAGGAAATTG GAAACCAAAAATGATAGGAGGAATTGGGGGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAA ATTTGTGGAAAAAAGGCTATAGGTACAGTACTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAACA TGTTGACTCAGCTTGGATGCACACTAAATTTTCCAATTAGTCCCATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAGGTCAAACAATGGCTATTGACAGAAGAGAAAATAAAAGCATTAACAGCA ATTTGTGATGAAATGGAGAGGGAAGGAAAAATTACAAAAATTGGGCCTGAAAATCCATATAACACTCCAG TATTTGCCATAAAAAAGAAGGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGAGAACTCAATAAAAG AACTTAAGACTTTTGGGAAGTTCAATTAGGGATACCACACCCAGCAGGGTTAAAAAAGAAAAAATCAGTG ACAGTACTGGATGTGGGAGATGCATATTTTTCAGTACCTTTAGATGAAGGCTTTAGGAAATATACTGCAT TCACCATACCTAGTATAAACAATGAAACACCAGGGATTAGATATCAATATAATGTGCTTCCACAGGGATG GAAAGGATCACCATCAATATTCCAGAGTAGTACGACAAAAATCTTAGAGCCCTTTAGGGCACAAAATCCA GAAATAATTATCTATCAATATATGGATGACTTGTATGTAGGATCTGACTTAGAAATAGGGCAACATAGAG CAAAAATAGAGGAGTTAAGAGAACATCTATTGAAGTGGGGATTCACCACCCCAGACAAGAAACATCAGAA AGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGACAAATGGACAGTACAGCCTATACAGCTG CCAGAAAAGGATAGCTGGACCGTCAATGATATACAGAAGTTAGTGGGAAAATTAAACTGGGCAAGTCAGA TTTACCCAGGGATAAAAGTAAGACAATTGTGTAAACTCCTTAGGGGAGCCAAAGCACTAACAGACATAGT GCCACTAACTGAAGAAGCAGAATTAGAATTGGCAGAGAACAGGGAAATTCTAAAAGAACCAGTACATGGA GTATATTATGATCCATCGAAAGACTTAATAGCTGAGATACAGAAACAAGGGCAGAACCAATGGACATATC AAATCTACCAAGAACCATTCAAAAATCTGAAAACAGGAAAATATGCAAAAATGAGGACTGCCCACACTAA TGATGTAAGACAGTTAACAGAGGCAGTGCAAAAAATAGCCCTGGAAAGCATAATAATATGGGGAAAGACT CCTAAATTTAGATTACCCATCCAGAAAGAAACATGGGAAGCATGGTGGACAGACTATTGGCAGGCCACCT GAATTCCTGAGTGGGAGTTTGTTAATACTCCTCCCTTAGTAAAATTATGGTACCAGCTGGAGAAAGAACC CATAGCAGGAGCAGAAACTTTCTATGTAGACGGAGCAGCTAATAGGGAAATTAAAATGGGAAAAGCAGGG TATGTTACTGACAGAGGAAGGCAGAAAATTGTTTCTATAACTGAAACAACAAATCAGAAGACTGAGTTAC AAGCAATTCAGCTAGCTTTACAGGATTCAGGATCAGAAGTAAACATAGTAACAGACTCACAGTATGCATT AGGAATTATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTCAATCAAATAATAGAACAGTTAATA AAGAAGGAAAGGGTCTACCTGTCATGGGTACCAGCACATAAAGGAATTGGGGGAAATGAACAAGTAGATA AATTAGTAAGTAGTGGAATCAGGAAAGTGCTGTTTCTAGATGGAATAAATAAGGCTCAAGAAGAGCATGA AAAATATCACAGCAATTGGAGAGCAATGGCTAGTGAGTTTAATCTGCCACCCATAGTAGCAAAAGAAATA GTAGCTAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCACACATGGACAAGTAGACTGTAGTCCAGGAA TATGGCAATTAGATTGTACACATTTAGAAGGAAAAATCATCCTGGTAGCAGTCCATGTAGCCAGTGGATA CATAGAAGCAGAGGTTATCCCAGCAGAAACAGGGCAAGAAACAGCATACTTTATACTAAAATTAGCAGGA AGATGGCCAGTCAAAGTAATACATACAGACAATGGCAGTAATTTCATCAGTAATACAGTTAAAGCAGCCT GTTGGTGGGCAGGTATCCAACAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAGGGAGTAGTAGAATC AATGAATAAAGAATTAAAGAAAATCATAGGACAGGTAAGAGATCAAGCTGAGCACCTTAAGACAGCAGTA CAAATGGCAGTATTCATTCACAATTTTAAAAGAAA-GGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAATAGATATAATAGCAACAGACATACAAACTAAAGAACTACAAAAACAAATTATGAAAATTCAAAATTT TCGGGTTTATTACAGAGACAGCAGAGATCCTATTTGGAAAGGACCAGCCAAACTACTCTGGAAAGGTGAA GGGGCAGTAGTACTACAAGATAACAGTGACATAAAGGTAGTACCAAGGAGGAAAGTAAAAATCATTAAGG ACTATGGAAAACAGATGGCAGGTGCTGATTGTATGGCAAGTAGACAGGATGAAGAT-------------- ----------------TAG ; D-NDK TTTTTTAGGGAAGATTTGGCCTTCCCACAAGGGAAGGCCGGGGAATTTTCTTCAGAGCAG------ACCA GAGCCAACAGCCCCACC---------------------------------AGCAGAGAGCTTCGGGTTTG GGGAGGAGAT---------------AACCCCCTCTCAGAAACAGGAGCA---GAAAGACAAGGAACT--- GTATCCTTTAGCTTCCCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGACAGC TAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATAAATTTGCCAGGAAAATG GAAGCCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTCATAGAA ATCTGTGGATATAAAGCTATGGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATT TGTTGACCCAGATTGGCTGCACTTTAAATTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAA ATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATATAATACTCCAA TATTTGCCATAAAGAAAAAAGACAGTACCAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAG AACTCAAGATTTCTGGGAGGTTCAATTAGGAATACCGCATCCTGCAGGGCTGAAAAAGAAAAAATCAGTA ACAGTACTGGATGTGGGTGATGCATATTTCTCAGTTCCCTTAGATGAAGATTTTAGGAAATATACCGCAT TTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTCCCACAGGGATG GAAAGGATCACCGGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCA GAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAA CAAAAATAGAGGAATTAAGAGAACATCTATTGAGGTGGGGATTTACCACACCAGATAAAAAACATCAGAA AGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAAACCTG CCAGAAAAAGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGGAAATTAAACTGGGCAAGCCAGA TTTATGCAGGAATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAGT ACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATTCTAAAAGAACCAGTACATGGA GTGTATTATGACCCATCAAAAGACTTAATAGCAGAACTACAGAAACAAGGGGACGGCCAATGGACATACC AAATTTATCAAGAACCATTTAAAAATCTAAAAACAGGAAAGTATGCAAGAACGAGGGGTGCCCACACTAA TGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCACAGAAAGCATAGTGATATGGGGAAAGACT CCTAAATTTAAACTACCCATACAAAAGGAAACATGGGAAACATGGTGGATAGAGTATTGGCAAGCCACCT GGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACC CATAATAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGAGAGACTAAATTAGGAAAAGCAGGA TATGTTACTGACAGAGGAAGACAGAAAGTTGTCCCTTTCACTGACACGACAAATCAGAAGACTGAGTTAC AAGCAATTAATCTAGCTTTACAGGATTCGGGATTAGAAGTAAACATAGTAACAGATTCACAATATGCACT AGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTCAGTCAAATAATAGAGCAGCTAATA AAAAAGGAAAAGGTTTACCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATA AATTAGTCAGTCAGGGAATCAGGAAAGTACTATTTTTGGATGGAATAGATAAGGCTCAGGAAGAACATGA GAAATATCACAACAATTGGAGAGCAATGGCTAGTGATTTTAACCTACCACCTGTGGTAGCGAAAGAAATA GTAGCTAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAA TATGGCAATTAGATTGTACACATCTGGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGCTA TATAGAAGCAGAAGTTATTCCAGCAGAAACGGGGCAAGAAACAGCATACTTTCTCTTAAAATTAGCAGGA AGATGGCCAGTAAAAGTAGTACATACAGATAATGGCAGCAATTTCACCAGTGCTACAGTTAAGGCCGCCT GTTGGTGGGCAGGGATCAAACAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAAGCTGAACATCTTAAGACAGCAGTA CAAATGGCAGTATTTATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAA TAATAGACATAATAGCAACAGACATACAAACTAGAGAATTACAAAAACAAATCATAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAGATCCAATTTGGAAAGGACCAGCAAAGCTTCTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGACAATAGTGACATAAAGGTAGTACCAAGAAGAAAAGTAAAGATCATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGAT-------------- ----------------TAA ; D-Z2Z6 TTTTTTAGGGAAGATTTGGCCTTCCCACAAGGGAAGGCCGGGGAACTTTCTTCAGAGCAG------ACCA GAGCCAACAGCCCCACC---------------------------------AGCAGAGAGCTTCGGGTTTG GGGAAGAGAT---------------AACCCCCTCTCAGAAACAGGAGCA---GAAAGACAAGGAACT--- GTATCCTTCAACTGCCCTCAAATCACTCTTTGGCAACGACCCCTTGTTACAATAAAAATAGGGGGACAGC TAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAAATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTCATAGAA ATCTGTGGGCATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATT TGTTGACCCAGATTGGCTGCACTTTAAATTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAA ATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAGAGTTGGGCCTGAAAATCCATACAATACTCCCA TATTTGCCATAAAGAAAAAAGACAGTACCAAGTGGAGAAAATTAGTAGATTTCAGGGAACTTAATAAGAG AACTCAAGATTTCTGGGAAGTTCAATTAGGAATACCGCATCCGGCAGGGCTAAAAAAGAAAAAATCAGTA ACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTTAGGAAATATACTGCAT TTACCATACCTAGTATAAATAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATG GAAAGGATCACCGGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCA GAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAA CAAAAATAGAGGAATTAAGAGAACATCTATTAAGGTGGGGATTTACCACACCAGATAAAAAACATCAGAA AGAACCCCCATTTCTTTGGATGGGGTATGAACTCCATCCTGATAAATGGACAGTACAGTCTATAAAATTG CCAGAAAAGGAGAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGGAAATTAAACTGGGCAAGCCAGA TTTATCCAGGAATTAAAGTAAGGCAATTGTGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAAT ACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATTCTAAAAGAACCAGTACATGGA GTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCACGGCCAATGGACATACC AAATTTATCAAGAACCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAA TGATGTAAAACAATTAGCAGAGGTAGTGCAAAAAATATCCACAGAAAGCATAGTGATATGGGGAAAGACT CCTAAATTTAGATTACCCATACAAAAGGAAACATGGGAAACATGGTGGGTAGAGTATTGGCAAGCCACTT GGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACC CATAATAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGAGAGACTAAATTAGGAAAGGCAGGA TATGTTACTGACAGAGGAAGACAGAAAGTTGTCCCTTTTACTGATACAACAAATCAGAAGACTGAGTTAC AAGCAATTAATTTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGATTCACAATATGCATT AGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTCAGTCAAATAATAGAGCAGTTAATA AAAAAGGAAAAGGTTTACCTGGCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATA AATTAGTCAGTCAGGGAATCAGGAAAGTACTATTTTTGGATGGAATAGATAAAGCTCAAGAAGAACATGA GAAATATCACAACAATTGGAGAGCAATGGCTAGTGATTTTAACCTACCACCTGTGGTAGCAAAAGAAATA GTAGCTAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAA TATGGCAATTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGCTA TATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTATTTTAAAATTAGCAGGA AGATGGCCAGTAAAAATAGTACATACAGACAATGGCAGCAATTTCACCAGTGCTGCAGTTAAGGCTGCCT GTTGGTGGGCAGGTATTAAACAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAAGAATTGAAGAAAATTATAGGACAGGTAAGAGATCAAGCTGAGCATCTTAAGACAGCTGTA CAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAGAGAA TAATAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATCACAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAGATCCAATTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGACAATAGTGACATAAAGGTAGTACCAAGAAGAAAAGTAAAGATTATCAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGAT-------------- ----------------TAG ; D-ELI TTTTTTAGGGAGAATTTGGCCTTCCCACAAGGGAAGGCCGGGGAACTTTCTCCAAAGCAG------ACCA GAGCCAACAGCCCCACC---------------------------------AGCAGAGAGCTTCGGGTTTG GGGAAGAGAT---------------AACCCCCTCTCAAAAACAGGAGCA---GAAAGACAAGGAACT--- GTATCCTTTAACTTCCCTCAAATCACTCTTTGGCAACGACCCCTTGTCGCAATAAAAATAGGGGGACAGC TAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAATTTGCCAGGAAAATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACCCATAGAA ATCTGTGGACAGAAAGCTATAGGTACAGTATTAGTAGGACCTACGCCTGTCAACATAATCGGAAGAAATT TGTTGACCCAGATTGGCTGCACTTTAAATTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAA ATTTGTACAGATATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAA TATTTGCCATAAAGAAAAAAGACAGTACCAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAG AACTCAAGATTTCTGGGAAGTTCAATTAGGAATACCGCATCCTGCAGGGCTGAAAAAGAAAAAATCAGTA ACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGATTTTAGGAAATATACCGCCT TTACCATATCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATG GAAAGGATCACCGGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCA GAAATGGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGA CAAAAATAGAGAAATTAAGAGAACATCTATTGAGGTGGGGATTTACCAGACCAGATAAAAAACATCAGAA AGAACCCCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGTCTATAAAACTG CCAGAAAAGGAGAGCTGGACTGTCAATGATATACAGAACTTAGTGGAGAGATTAAACTGGGCAAGCCAGA TTTATCCAGGAATTAAAGTAAGACAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAAT ACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATTTTAAAAGAACCAGTACATGGA GTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCACGGCCAATGGACATACC AAATTTATCAAGAACCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAA TGATGTAAAGCAATTAGCAGAGGCAGTGCAAAGAATATCCACAGAAAGCATAGTGATATGGGGAAGGACT CCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAACATGGTGGGCAGAGTATTGGCAAGCCACTT GGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACC CATAATAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGAGAGACTAAATTAGGAAAAGCAGGA TATGTTACTGACAGAGGAAGACAGAAAGTTGTCCCTTTGACTGACACGACAAATCAGAAGACTGAGTTAC AAGCAATTAATCTAGCCTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGATTCACAATATGCATT AGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTCAATCAAATAATAGAGCAGTTAATA AAAAAGGAAAAGGTTTACCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATA AATTAGTCAGTCAAGGAATCAGGAAAGTACTATTTTTGGATGGAATAGATAAGGCTCAAGAAGAACATGA GAAATATCACAACAATTGGAGAGCAATGGCTAGTGATTTTAACCTACCACCCGTGGTAGCAAAAGAAATA GTAGCTAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAA TATGGCAATTAGATTGTACACACTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGCTA TATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTTAAAATTAGCAGGA AGATGGCCAGTAAAAGTAGTACATACAGACAATGGCAGCAATTTCACCAGTGCTGCAGTTAAGGCCGCCT GTTGGTGGGCAGGTATCAAACAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAAGCTGAACATCTTAAGACAGCAGTA CAAATGGCAGTATTCATCCACAATTTTAAAAGAAGAAGGGGGATTGGGGGATACAGTGCAGGGGAAAGAA TAATAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTATAAAAATTCAAAATTT TCGGGTTTATTACAGAGACAGCAGAGATCCAATTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGACAAGAGTGACATAAAGGTAGTACCAAGAAGAAAAGTAAAGATTATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGAT-------------- ----------------TAA ; D-94UG114.1 TTTTTTAGGGAAAATTTGGCCTTCCCACAATGGAAGGCCAGGGAATTTCCTTCAGAGCAGACCCCCAGCA GAGCCAACAGCCCCACC---------------------------------AGCAGAGATCTTCGGATTAG GGGAGGAGAT---------------AACACCTCCTCAGAAACAGGAGCA---GAAAGACAAGGAACT--- GTATCCTTTAACCTCCCTCAAATCACTCTTTGGCAACGACCCGTTGTCACAGTAAAGATAGGGGGACAGC TAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATAAATTTGCCAGGAAAATG GAAACCAAAAATGATAGGGGGAATTGGGGGCTTTATCAAAGTAAGACAGTATGATCAAATACCCTTAGAA ATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATT TGTTGACTCAGATTGGTTGCACTTTAAATTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAA GCCAGGGATGGATGGCCCAAAAGTTAAACAATGGCCGTTGACAGAAGAAAAAATAAAAGCACTAATAGAA ATTTGTTCAGAACTAGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAACCCATACAATACTCCAA TATTTGCCATAAAGAAAAAAGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAG AACTCAAGACTTTTGGGAAGTTCAACTAGGAATACCACATCCTGCAGGGCTAAAAAAGAAAAAATCAGTA ACAGTACTGGATGTGGGTGACGCATATTTTTCAGTTCCCTTACATGAAGACTTTAGAAAATATACCGCAT TCACCATACCTAGTACAAACAATGAGACACCAGGAATTAGATATCAGTACAATGTGCTTCCACAAGGATG GAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCA GAAATGATTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAA TAAAAATAGAGGAATTAAGGGGACACCTCTTGAAGTGGGGATTTACCACACCAGACAAAAAGTATCAGAA AGAACCCCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAGTGGACAGTACAGCCTATACATCTG CCAGAAAAGGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGCCAGA TTTATCCAGGAATTAAAGTAAGACAATTATGCAAATGCCTTAGGGGAGCCAAAGCACTGACAGAAGTAAT ACCACTGACAGCAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATACTAAAAGAACCAGTACATGGA GCGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCAAGATCAATGGACATATC AAATATATCAAGAACAATATAAAAATCTGAAAACAGGAAAGTATGCGAAAATGAGGGGTACCCACACTAA TGATGTAAAACAATTAACAGAGGCAGTGCAGAAAATAGCCCAAGAATGTATAGTAATATGGGGAAAGACT CCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAGGCCACCT GGATTCCTGAGTGGGAGTATGTCAACACCCCTCCTTTAGTTAAATTATGGTATCAGTTAGAGAAGGAACC CATAGTAGGAGCAGAAACTTTCTATGTAGATGGGGCAGCTAATAGAGAGACTAAAATAGGAAAAGCAGGA TATGTTACTGACAGAGGAAGACAGAAAGTTGTCTCTCTAACTGACACAACAAATCAGAAGACTGAATTAC AAGCCATTAATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATT AGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGGTAGTCAGTCAAATAATAGAGCAGTTAATA AAAAAGGAAAAGGTCTACCTGTCATGGGTACCAGCACACAAGGGGATTGGAGGAAATGAACAAGTAGATA AATTAGTCAGTAATGGAATCAGAAAAATACTATTTTTGGATGGAATAGATAAGGCTCAAGAAGAACATGA GAAATACCACAACAATTGGAGGGCAATGGCTAGTGAGTTTAACCTGCCACCTGTAGTAGCAAAAGAAATA GTAGCCAGCTGTGATAAATGTCAGGTGAAAGGAGAAGCCTTGCATGGACAAGTAGACTGTAGTCCAGGAA TATGGCAATTAGATTGTACACATTTAGAAGGAAAAGGTATCCTGGTAGCAGTCCATGTAGCCAGTGGTTA TATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCCTACTTTCTTTTGAAATTAGCAGGA AGATGGCCAGTAAAAGTAGTACATACAGATAATGGCAGCAATTTCACCAGCGCTGCAGTAAAGGCCGCCT GTTGGTGGGCAGGTATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAAGAATTAAAGAAAATTATCGGGCAGGTAAGAGAACAAGCTGAACATCTTAAGACAGCAGTA CAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAATAGATATCATAGCAACAGACATACAAACTAAGGAATTACAAAAACAAATCATAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAGATCCAGTTTGGAAAGGACCAGCAAAGCTTCTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGACAATAGTGAAATAAAGGTAGTACCAAGAAGAAAAGCAAAGATTATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGAT-------------- ----------------TAG ; F-93BR020.1 TTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCCGGAAACTTCATCCAGAACAG------GCCA GAGCCGTCAGCCCCGCC---------------------------------AGCAGAGAGCTTCAGGTTCG GGGAGGAGAC---------------AACCCCATCTCCGAAGCAGGAGCA---GAAAGACGAGGGACTGTA CCCTCCCTTAGCTTCCCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAATAAGAGTAGGGGGACAGC TAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGACGTAAATTTGCCAGGAAAATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAAACAGTATGATAGCATACTCATAGAA ATTTGTGGACACAGAGCTATAGGTACAGTGTTAGTAGGACCTACGCCTGTCAACATAATTGGAAGAAATA TGTTGACCCAGATTGGTTGTACTTTACATTTTCCAATTAGTCCTATTGAGACTGTACCAGTAAAATTGAA GCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAA ATATGTATGGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAG TATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGGAAATTAGTAGATTTCAGAGAACTTAATAAAAG AACTCAAGATTTTTGGGAGGTTCAATTAGGAATACCGCATCCAGCAGGGTTAAAAAAGAAAAAGTCAGTA ACAGTACTGGATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAGGATTTCAGGAAGTACACTGCAT CCACCATACCTAGTACCAACAATGAGACACCAGGAGTTAGGTACCAGTACAATGTGCTTCCACAAGGATG GAAAGGATCACCAGCAATATTCCAATATAGCATGACAAAAATCTTAGATCCCTTTAGAGCAAAAAATCCA GACATAGTTATCTACCAATACATGGATGATTTGTATGTAGGGTCTGACTTAGAAATAGGACAGCATAGAA CAAAAATAGAAGAGTTAAGAGAACATCTACTGAAATGGGGATTAACTACACCAGACAAAAAACATCAAAA AGAACCCCCATTCCTTTGGATGGGGTATGAACTCCATCCTGATAAATGGACAGTGCAGCCTATACAATTG CCAGACAAGGACAGCTGGACTGTCAATGATATACAGAAGTTAGTAGGAAAACTAAATTGGGCAAGTCAGA TTTATCCAGGGATTAAAGTAAAACAATTATGTAAACTCCTTAGGGGAGCCAAGGCACTAACAGACATAGT GCCACTGACTACAGAAGCAGAGTTAGAATTGGCAGAGAATAGGGAGATTCTAAAAGAACCAGTACATGGG GCATATTATGACCCGTCAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCAAGGGCAATGGACATATC AAATTTATCAAGAGCCATTTAAAAATCTAAAAACAGGAAAGTATGCAAAAATGAGGTCTGCCCACACTAA TGATGTAAAACAGTTAACAGAAGCAGTGCAAAAGATATCTCTAGAAAGCATAGTAATATGGGGCAAGACT CCTAAGTTTAGACTACCCATATTAAAAGAGACATGGGATACATGGTGGACAGAGTACTGGCAAGCCACCT GGATTCCTGAGTGGGAGTTTGTCAATACCCCCCCTCTAGTAAAACTATGGTATCAGTTAGAAACAGAGCC CATAGTAGGAGCAGAAACCTTCTATGTAGATGGGGCATCTAATAGAGAGACCAAAAAAGGAAAAGCAGGA TATGTTACTGACAGAGGAAGACAAAAAGCGGTCTCCCTAACTGAGACTACAAATCAGAAGGCTGAGTTAC AAGCAATTCAGTTAGCTTTACAGGATTCAGGATCAGAAGTAAACATAGTAACAGACTCACAGTATGCATT AGGAATCATTCAAGCACAACCAGATAAGAGTGAATCAGAGTTAGTCAATCAAATAATAGAGCAATTAATA AAAAAGGAAAAGGTCTACCTGTCATGGGTACCAGCACACAAAGGGATTGGAGGAAATGAACAAGTAGATA AATTAGTCAGTGCTGGAATCAGGAAAGTACTGTTTCTAGATGGGATAGATAAGGCACAAGAGGAACATGA AAAATATCACAACAATTGGAGAGCAATGGCTAGTGATTTTAATATACCAGCTGTAGTAGCAAAAGAAATA GTAGCTAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATGCATGGACAAGTAGATTGTAGCCCAGGGA TATGGCAATTAGATTGCACACATTTAGAAGGAAAAATTATCCTGGTAGCAGTCCATGTAGCTAGTGGGTA CCTAGAAGCAGAAGTTATCCCAGCAGAAACAGGACAAGAGACAGCCTACTTCCTACTAAAGTTAGCAGGA AGATGGCCAGTAAAAACAATACATACAGACAATGGCACCAATTTCACCAGTGCCACGGTTAAGGCAGCTT GTTGGTGGGCAGGTATCCAGCAGGAATTTGGAATTCCTTACAACCCCCAAAGTCAAGGAGTAGTAGAATC TATGAATAAAGAGCTAAAGAAAATCATAGGACAGATAAGAGATCAAGCTGAACATCTTAAGACAGCAGTC CAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAA CAATAGACATAATAGCAACAGACATACAAACTAGAGAATTACAAAAACAAATTATAAAAATTCAAAATTT CCGGGTTTATTACAGGGACAGCAGAGACCCAGTTTGGAAAGGACCAGCAAAGCTACTCTGGAAAGGTGAA GGGGCAGTAGTCATACAAGACAATAGTGAAATAAAGGTAGTTCCAAGAAGAAAAGCAAAGATCATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAGGAT-------------- ----------------TAA ; ;G-92NG003.2(g3) ;TTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCAGGGAATTTTCTTCAGAACAG------GCCA ;GAGCCAACAGCCCCACC---------------------------------CGCAGAGAGCTTCGGGTTCG ;GAGAGGAGAT---------------AGCCCCTTCCCTGAAGCAGGAGCC---GAGGGAAAAGGAATC--- ;ACCTCCATTAACCTCCCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAGTAAGAATAGGGGGACAGC ;TAATAGAAGCTCTATTAGACACAGGAGCAGATGATACAGTATTAGAACAAATAAATTTACCAGGAAAATG ;GAAACCAAAAATGATAGGGGGAATTGGAGGATTTATCAAAGTAAAACAGTATGATCAAATACTTATAGAA ;ATTGAAGGGAAAAAGGCTATAGGGACAGTACTAGTAGGACCTACACCTATCAACATAATTGGGAGAAATA ;TGTTGACTCAAATTGGTTGTACTTTAAATTTTCCAATTAGTCCTATTGAGACTGTACCAGTAAAATTAAA ;ACCAGGAATAGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAACAGAA ;ATTTGTACAGATATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCAGAAAATCCATACAACACTCCAA ;TATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAGTTGGTAGATTTCAGAGAGCTCAATAAAAG ;AACTCAAGACTTCTGGGAGGTCCAATTAGGCATACCTCATCCCGCGGGGTTAAAAAAGAAAAGATCAGTA ;ACAGTACTAGATGTGGGGGATGCATATTTTTCAATTCCCCTAGATGAAAACTTTAGAAAGTATACAGCAT ;TCACTATACCTAGTATAAATAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCGCAAGGATG ;GAAAGGATCACCAGCAATATTTCAGAGTAGCATGACAAAAATCTTAGAACCCTTTAGAACAGAAAATCCA ;GAAATAGTGATCTATCAGTACATGGATGATTTATATGTAGGATCTGACTTAGAAACAGGGCAGCATAGAG ;CAAAAATAGAGGAATTAAGAAATCATCTACTGAGATGGGGATTTACCACACCAGATAAAAAACATCAGAA ;AGAACCTCCATTTCTCTGGATGGGATATGAGCTCCATCCTGACAAATGGACGGTACAACCTATACAGCTG ;CCAAACAAAGAAAGCTGGACTGTCAATGATATACAAAAATTAGTGGGAAAACTAAATTGGGCAAGTCAGA ;TTTATCCAGGGATTAAAGTAAAGCAACTATGTAAACTCCTTAGGGGGGCCAAAGCACTAACAGACATAGT ;ACCACTGACTGAAGAAGCAGAATTAGAATTGGCAGAGAACAGGGAAATTCTAAAAGAACCTGTACATGGA ;GTCTACTATGACCCATCAAAAGAATTAATAGCAGAATTACAGAAACAAGGGTGCGACCAATGGACATATC ;AAATTTATCAAGAGCCATACAAAAATCTGAAAACAGGAAAGTATGCAAAAAGGGGGTCTGCCCACACTAA ;TGATGTAAAACAGTTAACAGAAGCAGTGCAAAAAATAGCCACAGAGAGCATAGTAATATGGGGAAAAGTT ;CCTAAATTTAAACTACCTATAAGGAAAGAAACATGGGAAGTATGGTGGACAGAATATTGGCAGGCCACCT ;GGATTCCTGATTGGGAGTTTGTCAATACCCCTCCTCTAGTAAAGTTATGGTATCGATTAGAAACAGAACC ;CATACCAGGAGCAGAAACTTACTATGTAGATGGGGCAGCTAATAAAGAAACAAAATTAGGAAAGGCAGGA ;TATGTTACTGACAGAGGAAAACAAAAAATTATCACCATACAGGAAACAACAAATCAAAAAACTGAATTAC ;ACGCAATTCAGCTAGCTTTGCAGGATTCAGGATCAGAAGTAAACATAGTAACAGACTCACAGTATGCATT ;AGGAATCATTCAAGCACAACCAGATAGGAGTGAATCAGAATTAGTCAATCAAATAATAGAACAGCTAATA ;AAAAAGGAAAAGGTCTACTTAACATGGGTACCAGCACACAAAGGAATTGGGGGAAATGAACAAGTAGATA ;AATTAGTCAGTAGTGGAATCAGAAAAGTACTGTTTTTAGATGGCATAGACAAAGCTCAAGAGGACCATGA ;AAGATATCACAGCAATTGGAGAGCAATGGCTAGTGATTTTAATCTGCCACCTATAGTAGCAAAAGAAATA ;GTGGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAA ;TATGGCAATTAGATTGCACACATCTAGAAGGAAAAGTCATTATAGTAGCAGTCCATGTAGCCAGTGGCTA ;TATAGAAGCAGAAGTTATCCCAGCAGAAACAGGACAGGAGACAGCATACTTCCTGCTAAAATTAGCAGGA ;AGATGGCCAGTAAAAGTAATACACACAGACAATGGCAGCAATTTCACCAGTGCTGCAATGAAAGCAGCCT ;GTTGGTGGGCAAATATCCAACAGGAATTTGGAATTCCCTACAATCCCCAAAGCCAAGGAGTAGTGGAATC ;TATGAATAAAGAATTAAAGAAAATTATAGGGCAGGTCAGGGATCAAGCTGAACACCTCAAGACAGCAGTA ;CAGATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA ;TAATAGACATAATAGCATCAGATATACAAACTAAAGAACTACAAAAACAGATTATAAAAATTCAAAATTT ;TCGGGTCTATTACAGGGACAGCAGAGACCCCATTTGGAAAGGACCAGCAAAACTACTCTGGAAAGGTGAA ;GGGGCAGTAGTAATACAGGACAATAGTGAGATAAAGGTAGTACCAAGAAGAAAAGTAAAAATCATTAAGG ;ATTATGGAAAACAGATGGCAGGTGGTGATTGTGTGGCAGGTAGACAGGATGAGGAT-------------- ;----------------TAG ; G-92NG083.1(jv10832 TTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCAGGAAACTTTCTCCAGAACAG------GACA GAGCCAACAGCCCCACC---------------------------------AGCAGAGAGCTTCGGATTCG GAGAGGAGAT---------------AGCCCCCTCCCCGAAGCAGGAGCC---AAAGGAGAAGGAGCT--- ATATCCCTTAACTTCCCTCAAATCACTCTTTGGCAGCGACCCCTAGTCACAGTAAAAATAGGGGGACAGC TAATAGAAGCCCTATTAGACACAGGAGCAGATGACACAGTATTAGAAGGAATAAATTTACCAGGAAAATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAA ATTGGTGGAAAAAAGGCTATAGGGACAGTATTAGTAGGACCTACACCTATTAACATAATTGGGAGAAATA TGTTGACTCAGATTGGTTGTACTTTAAACTTTCCAATAAGTCCTATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAGGGTTAAACAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAACAGAA ATTTGTAAAGACATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAACACTCCAA TATTCGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTGGTAGATTTCAGAGAACTTAATAAAAG AACTCAAGACTTCTGGGAGGTCCAATTAGGAATACCTCACCCCGCGGGGTTAAAAAAGAAAAGATCAGTA ACGGTACTAGATGTGGGAGATGCATACTTTTCAGTTCCCTTAGATAAAGACTTTAGAAAGTATACTGCAT TTACTATACCTAGTATAAATAATGAGACACCAGGGATTAGATATCAATACAATGTGCTTCCACAGGGATG GAAAGGATCACCAGCAATATTTCAGAGTAGCATGACAAAAATTTTAGAGCCTTCTAGAACAAAAAATCCA GAAATGGTGATCTACCAATACATGGATGATTTATATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAG CAAAAATAGAGGAGTTAAGAGAACATCTACTGAAATGGGGATTGACCACACCAGATAAAAAACATCAGAA AGAACCTCCATTCCTTTGGATGGGATATGAGCTCCATCCTGACAAATGGACGGTACAACCTATACAGCTG CCAGAAAAGGAAGATTGGACTGTCAATGATATACAAAAGTTAGTGGGAAAACTAAATTGGGCAAGTCAGA TTTATCCAGGGATTAAAGTAAAGCACCTATGTAGACTCCTTAGGGGGGCCAAAGCACTAACAGACATAGT ACCCCTAACGGCAGAAGCAGAAATGGAGCTGGCAGAGAACAGGGAAATTCTAAAAGAACCTGTACATGGA GTCTATCATGACCCATCAAAAGAATTAATAGCAGAAGTACAGAAGCAAGGGCCAGACCAATGGACATATC AAATTTATCAAGAGCCATACAAAAATCTAAAAACAGGAAAATATGCAAAAAGGGGGTCTGCCCACACTAA TGATGTAAAACAATTAACAGAAGTAGTGCAAAAAATAGCCACAGAGGGCATAGTAATCTGGGGAAAGATT CCTAAATTTAAACTACCTATACGAAAAGAAACATGGGAAGTATGGTGGACAGAGTACTGGCAGGCCGCCT GGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCTCTAGTAAAACTATGGTATCAATTAGAAACAGAACC CATACCAGGAGCAGAAACTTACTATGTAGATGGGGCAGCTAATAGGGAGACAAAATTAGGAAAGGCAGGA CATGTTACTGACAAAGGAAAACAAAAAATTATTACCCTAACTGAAACAACAAACCAAAAGGCTGAATTAC ATGCAATTCAACTAGCTTTGCAGGACTCAAGACCAGAAGTAAACATAGTAACAGACTCACAGTATGCATT AGGAATCATTCAAGCACAACCAGATAGGAGTGGATCAGAATTAGTCAATCAAATAATAGAACAGCTAATA AAAAAGGAAAAGGTCTACCTGTCATGGGTACCAGCACACAAAGGGATTGGAGGAAATGAACAAGTAGATA AGCTAGTCAGTAGTGGAATCAGGAAAGTATTATTTTTGGATGGCATAGATAAAGCCCAAGAAGAACATGA AAGATATCACAGCAATTGGAGAGCAATGGCTAGTGATTTTAATCTGCCACCTGTAGTAGCAAAAGAAATA GTGGCCAGCTGTGATAAATGTCAACTAAAAGGGGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAA TATGGCAATTAGATTGTACACATTTAGAAGGAAAAATTATCATAGTAGCAGTTCATGTAGCCAGTGGCTA TATAGAAGCAGAAGTTATCCCAGCAGAAACAGGGCAGGAAACAGCATACTTTATATTAAAATTAGCAGGA AGGTGGCCAGTAAAAGTGATACATACAGACAATGGTCCCAATTTCATCAGTGCTGCAGTAAAGGCAGCAT GTTGGTGGGCAAATATCACACAGGAATTTGGAATTCCCTACAATCCCCAAAGCCAAGGAGTAGTGGAATC TATGAATAAGGAATTAAAGAAAATCATCGGACAGGTTGGAGATCAAGCTGAACATCTTAAGACAGCAGTA CAGATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAATAGACATAATAGCATCAGATATACAAACTAAAGAACTACAAAAACAAATTATAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAGACCCAATTTGGAAAGGACCAGCAAAGCTACTCTGGAAAGGTGAA GGGGCAGTAGTAATACAGGACAATAACGAAATAAAGGTAGTACCAAGAAGAAAAGCAAAGATCCTTAAGG ATTATGGAAAACAGATGGCAGGTGGTGATTGTGTGGCAGGTAGACAGGATGAGGAT-------------- ----------------TAG ; H-90CR056.1(u40561) TTTTTTAGGGAAAATTTGGCCTTCCAGCAAAGGGAGGCCAGGAAATTTTCTCCAGAGCAG------GCCA GAACCAACAGCCCCACC---------------------------------AGCAGAGAGCTTCGGGTTCG GAGAGGAGAT---------------GACCCCCTCTCCGAAGCAGGAGCAGCTGAAGGACAAGGA------ ACCTCCCTTAGCTTCCCTCAGATCACTCTTTGGCAGCGACCCCTTGTTACAGTAAAAATAGAGGGACAGT TAAGGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAGATAAATTTGCCGGGAAAATG GAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAGCAAGTAGCCATAGAA ATCTGTGGAAAAAAGGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAATATAATTGGAAGGAATA TATTGACTCAAATTGGTTGCACCTTAAATTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAA GCCAGGAATGGATGGCCCAAAGGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACGGAA ATTTGTACAGAGATGGAAAAAGAAGGAAAAATCTCAAGAATAGGGCCTGAGAATCCATACAGCACTCCAA TATTTGCCATAAAAAAGAAGGATAGTACTAAATGGAGAAAATTAGTGGATTTCAGAGAACTCAATAAAAG AACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACACCCAGCAGGGTTAAAAAAGAAAAAATCAGTA TCAGTACTGGATGTGGGGGATGCATATTTTTCAGTCCCTTTAGATAAAGAATTCAGAAAGTATACTGCAT TCACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTATAATGTGCTTCCACAGGGATG GAAAGGATCACCAGCAATATTCCAGAGTAGCATGACAAAAATCTTAGCGCCCTTTAGAGAACAAAATCCT GAAATGGTTATTTACCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAACATAGAG CAAAAATAGAGGAGTTAAGAGCTCATTTGTTGAAATGGGGATTTACCACACCAGACAAAAAACATCAGAA AGAACCCCCATTTCTTTGGATGGGATATGAACTCCATCCTGACAAATGGACAGTACAGACTGTAAAACTG CCAGAAAAAGACAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAACTAAATTGGGCAAGTCAGA TTTATCCAAATATTAAAGTAAAGCAACTATGTAAACTCCTTAGGGGGGCCAAAGCATTAACAGACATAAT ACCACTGACAAAAGAGGCAGAATTGGAATTGGCAGAAAACAGGGAGATTCTGAGAGAACCAATACATGGA GTATATTATGATCCATCAAAAGACTTAATAGCAGAAATACGGAAGCAAGGGCAAGGCCAATGGACATATC AAATTTATCAGGAGCCATTTAAAAATCTGAAGACAGGAAAATATGCAAAAATGAGAACTGCCCACACTAA TGATATAAAACAATTAACAGAAGCAGTGCAAAAGATATCTACAGAAAGCATAGTAATATGGGGAAAAATT CCTAAATTTAGACTACCTATACAAAAAGAAACATGGGAGACCTGGTGGACAGAGTATTGGCAAGCCACAT GGATTCCTGAATGGGAGTTTGTTAACACCCCTCATCTAGTAAAATTATGGTATCAGTTAGAAACAGAGCC CATAGCAGGAGCAGAAACTTACTATATAGATGGGGCAGCTAATAGGGAAACTAAATTAGGAAAAGCAGGA TATGTCACTGATAGAGGAAAGCAAAAAGTTGTCTCCCTAACGGAAACAACAAATCAGAAGACTGAATTAC AAGCAATTTATCTAGCTTTGCAAGATTCAGGGTTAGAAGTGAACATAGTGACAGATTCACAGTATGCACT AGGAATCATTCAAGCACAACCCGATAAGAGTGAATCAGAGTTAGTTAATCAAATAATAGAGGAATTAATA AAGAAGGAAAAGGTCTACCTGTCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATA AATTAGTTAGTTCTGGAGTCAGAAAAGTGCTATTTCTAGATGGGATAGATAAAGCTCAAGAAGAACATGA AAGGTATCATAACAATTGGAGAGCAGTGGCTAGTGATTTTAATCTACCACCTATAGTAGCAAAAGAAATA GTAGCTAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATGCATGGACAAGTAGACTGTAGCCCAGGAA TATGGCAATTAGATTGCACACATTTGGAAGGACAAGTTATTCTGGTAGCAGTCCATGTAGCCAGTGGCTA TATAGAAGCAGAAGTCATCCCAGCAGAAACAGGAAAGGAAACAGCATACTTCCTGTTGAAACTAGCAAGC AGATGGCCAGTAAAAGTAATACATACAGACAATGGCAGCAATTTCACGAGTGCTGCGGTTAAGGCAGCCT GTTGGTGGGCAGATATCCAACAGGAATTTGGGATTCCCTACAATCCCCAAAGTCAGGGAGTAGTAGAATC TATGAATAAAGAATTAAAGAAGATCATAGGGCAGGTAAGAGACCAAGCAGAACACCTTAAGACAGCAGTA CAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAA TAATAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTTCAAACATTCAAAAATT TCGGGTTTATTACAGGGACAGCAGAGACCCAATTTGGAAAGGACCAGCAAAACTCCTCTGGAAAGGTGAA GGGGCAGTAGTAATACAAGACAATAGTGAAATAAAAGTAGTACCAAGAAGAGAGGCAAAAATCATTAGGG ATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGAT-------------- ----------------TAA ; O-ANT70 TTTTTTAGGCAAATACTGGCCTCCGGGGGGCACGAGGCCAGGCAATTATGTGCAGAGACC------AGCA CACCCATCAGCCCCACC---------------------------------GATGGAGGAGGAAGTGAAGG GACAGGAGAA------------------------TCAGGAACAGAAAGG---GGGCCCGAACGAGCT--- CTATCCGTTTGCCTCCCTCAAATCCCTCTTTGGGACAGACCAATAGTTACAGCAAGAGTTGGGGGCCACC TATGTGAAGTTTTGCTGGATACAGGAGCAGATGACACAGTACTAAACAACATACAATTGGAAGGAAAATG GAAACCAAAAATGATAGGGGGTATAGGAGGTTTTATAAAAGTAAAAGAATATGATAATGTGACAGTAGAA ATAGAAGGAAGGGAGGTACAGGGAACAGTATTGGTGGGACCTACTCCTGTTAATATTATTGGAAGAAATA TATTGACAGGATTAGGTTGTACACTAAACTTCCCTATAAGCCCCATAGCCCCAGTGCCAGTAAAACTAAA ACCAGGAATGGATGGACCAAAAGTAAAACAATGGCCCCTATCTAAAGAAAAAATAGAAGCCTTGACAGCA ATATGTCAGGAAATGGAACAAGAAGGAAAAATTTCAAGAATAGGACCTGAAAATCCTTATAATACACCTA TCTTTGCTATAAAAAAGAAAGATGGTACTAAATGGAGAAAATTGGTAGATTTTAGGGAATTAAATAAGAG AACACAAGAGTTCTGGGAGGTACAGCTAGGTATCCCACATCCGGGGGGTTTGAAGCAAAAGCAATCTGTT ACAGTCTTAGATGTAGGAGATGCTTATTTCTCATGTCCCTTAGACCCAGATTTTAGAAAATATACTGCTT TCACTATTCCTAGTGTGAATAATGAGACCCCAGGAATAAGATACCAGTACAATGTCCTCCCGCAAGGATG GAAAGGTTCACCAGCTATATTCCAAAGTTCAATGACAAAAATTCTAGATCCATTCAGGAGAGACAACCCA GAATTAGAAATTTGTCAGTACATGGATGACCTATATGTAGGATCAGATTTACCCCTGACAGAACATAGAA AAAGGATTGAATTGCTTAGAGAACACCTATATCAGTGGGGATTCACTACCCCTGACAAAAAGCATCAAAA GGAACCTCCCTTTCTATGGATGGGGTATGAGCTCCATCCAGACAAATGGACAGTACAGTCCATCCAATTG CCTAACAAGGATGTGTGGACAGTAAATGATATACAAAAACTAATAGGAAAGCTAAATTGGGCAAGTCAAA TCTATCAAGGAATTAGAGTGAGAGAATTGTGTAAGTTAATTAGAGGCACCAAGTCATTAACAGAAGTAGT ACCTTTAAGTAGAGAGGCAGAGCTGGAATTAGAGGAAAACAGAGAAAGGTTAAAACAACCAGTGCATGGG GTATACTATCAACCTGATAAGGATCTATGGGTTAATATTCAGAAGCAAGGAGGGGAGCAATGGACTTACC AGATATATCAGGAAGAACATAAGAACCTCAAAACAGGGAAATATACTAGGCAAAAGGCCTCCCACACAAA TGATATAAGACAATTAGCAGAAGTAATCCAGAAGGTGTCTCAAGAATCTATAATTATCTGGGGAAAATTG CCTAAATTTAAGCTGCCAGTCACTAGAGAAACTTGGGAAACATGGTGGGCGGACTATTGGCAAGCCACCT GGATTCCAGAATGGGAATTTGTCAGCACACCCCCATTGATCAAATTATGGTACAGGCTAGAAAGTGAACC TATTATGGGGGCAGAAACCTATTATGTAGATGGAGCAGCTAATAGAGAGACAAAACTAGGAAAGGCAGGA TATGTTACAGAACAAGGGAAACAGAAGATAATAAAATTAGATGAGACCACCAATCAAAAAGCTGAATTAA TGGCGATATTACTAGCCTTACAGGATTCCAAAGAAACAGTAAATATAGTAACAGATTCACAATATGCATT GGGCGTCATCTCCTCCCAACCTACACAGAGTGAATCCCCTATAGTTCAGCAAATAATAGAGGAACTAACA AAAAAGGAACAGGTGTATCTTACATGGGTTCCTGCCCATAAAGGCATAGGAGGAAATGAAAAAATAGATA AATTAGTAAGCAAGGATATTAGAAGAGTCCTGTTCCTAGAAGGAATAGACCAGGCACAAGAAGATCATGA AAAATATCATAGTAATTGGAAAGCACTAGCTAGTGAATTTGGACTACCACCAGTGGTGGCCAAGGAAATC ATTGCTAGCTGTCCTAAATGTCATATAAAAGGGGAAGCAATTCATGGTCAGGTAGACTGCAGTCCAGAAG TATGGCAAATAGATTGCACACATATGGAAGGCAAAATCATAATAGTTGCTGTCCATGTGGCAAGTGGGTT CATAGAAGCAGAAGTGATACCAGCAGAAACAGGACAAGAAACTGCCTACTTCCTGTTAAAACTGGCTGCA AGATGGCCTGTTAAAGTAATACATACAGACAACGGGCCTAATTTTACAAGTACAACTATGAAGGCTGCAT GTTGGTGGGCCAACATACAACATGAGTTTGGAATACCATATAATCCACAAAGTCAAGGAGTAGTAGAAGC CATGAATAAGGAATTAAAATCAATTATACAGCAGGTGAGGGACCAAGCAGAACACTTAAGAACAGCAGTA CAAATGGCAGTATTTGTTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACACTGCAGGAGAAAGGA TAATAGACATATTAGCATCACAAATACAAACAACAGAATTACAAAAACAAATTTTAAAANTTCACAAATT TCGGGTCTATTACAGAGACAGCAGAGACCCTATCTGGAAAGGACCGGCACAGCTCCTGTGGAAAGGTGAG GGAGCAGTAGTCATACAAGATAAGGGAGACATTAAGGTAGTACCAAGAAGGAAGGCAAAAATAATCAGAG AGTATGGAAAACAGATGGCAGGTACTGATAGTATGGCAAGTGGACAGACAGAAAGTGAAAGCGTGGAACA GCCTAGTGAAATACCATAA ; O-MVP5180 TTTTTTAGGGAAGTACTGGCCTCCGGGGGGCACGAGGCCAGGCAATTATGTGCAGAAACA------AGTG TCCCCATCAGCCCCACC---------------------------------AATGGAGGAGGCAGTGAAGG AACAAGAGAA------------------------TCAGAGTCAGAAGGG---GGATCAGGAAGAGCT--- GTACCCATTTGCCTCCCTCAAATCCCTCTTTGGGACAGACCAATAGTCACAGCAAAGGTTGGGGGTCATC TATGTGAGGCTTTACTGGATACAGGGGCAGATGATACAGTATTAAATAACATACAATTAGAAGGAAGATG GACACCAAAAATGATAGGGGGTATAGGAGGCTTTATAAAAGTAAAAGAGTATAACAATGTGACAGTAGAA GTACAAGGAAAGGAAGTACAGGGAACAGTATTGGTGGGACCTACTCCTGTTAATATTCTTGGGAGAAACA TATTGACAGGATTAGGATGTACACTAAATTTCCCTATAAGTCCCATAGCCCCAGTGCCAGTAAAGCTAAA ACCAGGAATGGATGGACCAAAAGTAAAACAATGGCCCCTATCTAGAGAGAAAATAGAAGCACTAACTGCA ATATGTCAAGAAATGGAACAGGAAGGAAAAATCTCAAGAATAGGACCTGAAAATCCTTATAATACACCTA TTTTTGCTATAAAAAAGAAAGATAGCACTAAGTGGAGAAAATTGGTAGACTTCAGAGAATTAAATAAAAG AACACAAGATTTCTGGGAGGTGCAATTAGGTATTCCACATCCAGGGGGTTTAAAGCAAAGGCAATCTGTT ACAGTCTTAGATGTAGGAGATGCTTATTTCTCATGCCCTTTAGATCCAGACTTTAGAAAATACACTGCCT TCACTATTCCTAGTGTGAACAATGAGACCCCAGGAGTAAGATACCAGTACAATGTCCTCCCGCAAGGGTG GAAAGGTTCACCAGCCATATTTCAGAGTTCAATGACAAAGATTCTAGATCCATTTAGAAAAAGCAACCCA GAAGTAGAAATTTATCAGTACATAGATGACTTATATGTAGGATCAGATTTACCATTGGCAGAACATAGAA AGAGGGTCGAATTGCTTAGGGAACATTTATATCAGTGGGGATTTACTACCCCTGATAAAAAGCATCAGAA GGAACCTCCCTTTTTATGGATGGGATATGAGCTCCACCCAGACAAGTGGACAGTACAGCCCATCCAATTG CCTGACAAAGAAGTGTGGACAGTAAATGATATACAAAAATTAGTAGGAAAATTAAATTGGGCAAGTCAAA TCTATCAAGGAATTAGAGTAAAAGAATTGTGCAAGTTAATCAGAGGAACCAAATCATTGACAGAGGTAGT ACCTTTAAGTAAAGAGGCAGAACTAGAATTAGAAGAAAACAGAGAAAAGCTAAAAGAGCCAGTACATGGA GTATATTACCAGCCTGACAAAGACTTGTGGGTTAGTATTCAGAAGCATGGAGAAGGGCAATGGACTTACC AGGTATATCAGGATGAACATAAGAACCTTAAAACAGGAAAATATGCTAGGCAAAAGGCCTCCCACACAAA TGATATAAGACAATTGGCAGAAGTAGTCCAGAAGGTGTCTCAAGAAGCTATAGTTATATGGGGGAAATTA CCTAAATTCAGGCTGCCAGTTACTAGAGAAACTTGGGAAACTTGGTGGGCAGAATATTGGCAGGCCACCT GGATTCCTGAATGGGAATTTGTCAGCACACCCCCATTGATCAAATTATGGTACCAGTTAGAAACAGAACC TATTGTAGGGGCAGAAACCTTTTATGTAGATGGAGCAGCTAATAGGAATACAAAACTAGGAAAGGCGGGA TATGTTACAGAACAAGGAAAACAGAACATAATAAAGTTAGAAGAGACAACCAATCAAAAGGCTGAATTAA TGGCTGTATTAATAGCCTTGCAGGATTCCAAGGAGCAAGTAAACATAGTAACAGACTCACAATATGTATT GGGCATCATATCCTCCCAACCAACACAGAGTGACTCCCCTATAGTTCAGCAGATAATAGAGGAACTAACA AAAAAGGAACGAGTGTATCTTACATGGGTTCCTGCTCACAAAGGCATAGGAGGAAATGAAAAAATAGATA AATTAGTAAGCAAAGACATTAGAAGAGTCCTGTTCCTGGAAGGAATAGATCAGGCACAAGAAGATCATGA AAAATATCATAGTAATTGGAGAGCATTAGCTAGTGACTTTGGATTACCACCAATAGTAGCCAAGGAAATC ATTGCTAGTTGTCCTAAATGCCATATAAAAGGGGAAGCAACGCATGGTCAAGTAGACTACAGCCCAGAGA TATGGCAAATGGATTGTACACATTTAGAAGGCAAAATCATAATAGTTGCTGTCCATGTAGCAAGTGACTT TATAGAAGCAGAGGTGATACCAGCAGAAACAGGACAGGAAACTGCCTATTTCCTGTTAAAATTAGCAGCA AGATGGCCTGTCAAAGTAATACATACAGACAATGGACCTAATTTTACAAGTGCAGCCATGAAAGCTGCAT GTTGGTGGACAGGCATACAACATGAGTTTGGGATACCATATAATCCACAAAGTCAAGGAGTAGTAGAAGC CATGAATAAAGAATTAAAATCTATTATACAGCAGGTGAGGGACCAAGCAGAGCATTTAAAAACAGCAGTA CAAATGGCAGTCTTTGTTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACACTGCAGGGGAGAGAC TAATAGACATACTAGCATCACAAATACAAACAACAGAACTACAAAAACAAATTTTAAAAATCAACAATTT TCGGGTCTATTACAGAGATAGCAGAGACCCTATTTGGAAAGGACCGGCACAACTCCTGTGGAAAGGTGAG GGGGCAGTAGTCATACAAGATAAAGGAGACATTAAAGTGGTACCAAGAAGAAAGGCAAAAATAATCAGAG ATTATGGAAAACAGATGGCAGGTACTGATAGTATGGCAAATAGACAGACAGAAAGTGAAAGCATGGAACA GCCTGGTGAAATACCATAA
last modified: Fri Aug 10 14:03 2007


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health