HIV Databases HIV Databases home HIV Databases home
HIV sequence database



; A-U455 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGA GAAAATTCGGTTAAGGCCAGGGGGAAACAAAAAATATAGACTGAAACATT TAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAACCCTGGCCTT TTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGC TCTCCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAG TCCTCTATTGTGTACATCAAAGGATAGATGTAAAAGACACCAAGGAAGCT TTAAATAAAATAGAGGAAATGCAAAATAAGAACAAG---CAAAGGACA-- ----CAGCAG---GCAGCAGCT---AACACAGGA------AGC------A GTCAAAATTACCCCATAGTGCAAAAT ; A-92UG037.1 ATGGGTGCGAGAGCGTCAGTATTAAGTGGGGGAAAATTAGATGCATGGGA GAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAGATTAAAACATC TAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTAACCCTAGCCTT TTAGAAACAACAGAAGGATGTCAACAAATAATGGAACAATTACAATCAGC TCTCAGAACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAA CCCTCTATTGCGTACATCAACGGATAGAGGTAAAAGACACCAAGGAAGCT CTAGATAAAATAGAGGAGATACAAAAGAAAAGCAAG---CAAAAGACA-- ----CAGCAG---GCAGCAGCT---GACACAGGAAGTAGCAGCAAGGTCA GCCAAAATTACCCTATAGTGCAAAAT ; A-K89 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATACGTGGGA GAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAACTGAAACATT TAGTATGGGCAAGCAGGGAGCTGGAAAGATTCGCACTTAACCCTAGCCTT TTAGAAACAACAGAAGGGTGTCAACAAATAATGGAACAATTACAACCAGC TCTCAAGACAGGGACAGAAGAACTTAGATCATTATTTAATACAGTAGCAA CCCTCTGGTGCGTACATCAACAAATAAATGTAAAAGACACCAAGGAAGCT CTGGATAAAATAGAGGAAATACAAAATAAGAACAAG---CAAAAAACA-- ----CAACAG---GCAGCAGCT---GATACAGGAAACAACAGCAAGGTTA GCCAAAATTACCCTATAGTGCAAAAT ; A-VI32 ATGGGTGCGAGAGCGTCAGTATTAAGTGGGGGAAAATTAGATGCATGGGA GAAAATTAGGTTAAGGCCAGGGGGAAAGAAAAAATATAGAATGAAACATT TAGTATGGGCAAGCAGGGAGCTGGACAGATTCGCACTTAACCCTAGCCTT CTGGAAACAAAAGAAGGATGTCAACAGATAATGGAACAGTTAGAATCAGC TCTCAAGACAGGAACAGAAGAAATTAAATCATTATATAATACAGTAGCAG TCCTCTTTTGTGTACATCAACGGATAGATGTAAAAGACACCAAGGAAGCC TTAGATAAAATAGAGGAAATAAAAAATAAGAGTAAG---CAAAAGGCA-- ----CAACAG---GCAGCAGCT---GACACAGGAAACAGCGGCAAAGTCA GCCAAAATTACCCTATAGTGCAAAAT ; B-HXB2 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGA AAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATA TAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTG TTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATC CCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAA CCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCT TTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAG---AAAAAAGCA-- ----CAGCAA---GCAGCAGCT---GACACAGGACACAGCAATCAGGTCA GCCAAAATTACCCTATAGTGCAGAAC ; B-JRFL ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTGGATAAATGGGA AAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAGATTAAAACATA TAGTATGGGCAAGCAGGGAGCTAGAACGTTTCGCAGTTAATCCTGGCCTG TTAGAATCATCAGAAGGCTGTAGACAAATACTGGGACAACTACTACCAGC CCTTAAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAA CCCTCTATTGTGTACATCAAAGGATAGAGGTAAAAGACACCAAGGAAGCT TTAGAAAAGATAGAGGAAGAGCAAGCCAAAAGTAAG---AAAAAA----- -------GAA---GCAGCAGCT---GACACAGGAAACAGCAGCCAGGTCA GCCAAAATTACCCTATAGTGCAGAAC ; B-OYI ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATAAATGGGA AAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATCAACTAAAACATA TAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAATTAATCCTGGCCTG TTAGAAACATCAGAAGGTTGTAGACAAATACTGGGACAGCTACAACCATC CCTTAAGACAGGATCAGAAGAAATTAGATCATTATATAATACAGTAGCAA CTCTTTATTGTGTGCATCAAAAGATAGAGGTAAAAGACACCAAGGAAGCT TTAGATAAGATAGAGGAAGAGCAAAACAAAAGTAAG---AAAAAAGCA-- ----CAGCAA---ACAGCAGCT---GACACAGGAAACAGCAGCCAGGTCA GCCAAAATTACCCTATAGTACAGAAC ; B-RF ATGGGTGCGAGAGCGTCAGTATTAAGCGGCGGAAAATTAGACAAATGGGA AAAAATTCGGTTAAGGCCAAGGGGAAAGAAAAGATATAAGTTAAAACATA TAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCTGTCAATCCTAGCCTT TTAGAGACAGCAGAGGGCTGTAGACAAATACTGGGACAGCTACAACCAGC CCTTCAGACAGGATCAGAAGAACTTAAATCATTATATAATGCAGTAGCAA CCCTCTATTGTGTACATCAAAATATAGAGGTAAGAGACACCAAGGAAGCT TTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAG---AAAAAAGCA-- ----CAGCAA---GCAGCAGCT---GACACAGGAAACGGCAGCCAGGTCA GCCAAAATTACCCTATAGTGCAGAAC ; C-ETH2220 ATGGGTGCGAGAGCGTCAATATTAAGAGGCGAAAAATTAGATGCCTGGGA AAAAATTAAGTTAAGGCCAGGGGGAAAGAAACACTATATGCTGAAACACC TAGTCTGGGCAAACAGGGAGCTGGAAAAATTTGCACTTAACCCTGACCTT TTAGATACATCAGCAGGCTGTAAACAAATAATTAAACAGCTACAACCAGC TCTTCAGACAGGAACAGAGGAACTTAAATCATTATTTAATACAGTGGCAA CTCTCTATTGTGTACATCAAAAGATAGAGATAAAAGACACCAAGGAAGCC TTAGACAAGATAGAGGAAGAACAAAACGAAAGTCAG---CAAAAAACA-- ----CAGCAGGCAGGAGCAGCT---GACAGAGGA---------AAGGACA GTCAAAATTATCCTATAGTGCAGAAT ; C-92BR025 ATGGGTGCGAGAGCGTCAATATTAAGAGGCGGAAAATTAGATGCTTGGGA AAGAATTAAGTTAAAGCCAGGGGGAAAGAAACACTATATGATGAAACACC TAGTCTGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTGACCCTGGCCTT TTAGAGACATCCGAAGGCTGTAAACAAATAATGAAACAGCTACAACCAGC TCTTCAGACAGGAACAAAGGAACTTATATCATTACATAATACGGTTGCAA CTCTCTATTGTGTACATGAAAAGATAGATGTACGAGACACCAAGGAAGCC TTAGACAAAATAAAGGAAGAACAAAACAAAAGTCAG---CAAAAAACA-- ----CAGCAG---GCAGAAGCGGCTGACAAAGGA---------AAGGTCA GTCAAAATTATCCTATAGTACAGAAT ; C-UG268 ATGGGTGCGAGAGCGTCAGTATTAAGAGGCGGAAAATTAGATACCTGGGA AAAAATTAAGTTAAGGCCAGGGGGAAAGAAATGCTATATGATGAAACACC TAGTCTGGGCAAGCAGGGAGCTGGGAAGATTTGCACTTAACTCTGGCCTT TTAGAAACATCAGAAGGCTGTAAACAAATAATGAAACAGCTACAACCAGC TCTTCAGACAGGGACAGATGAACTTAGATCATTATATAACACAGTAGCAA CTCTCTATTGTGTACATAAAGGGATAGAAGTACGAGACACCAAGGAAGCC TTAGACAAGATAGAGGAAGAACAAAACAAGATTCAG---CAAAAAACA-- -------GAA------ACAGCT---GACAAAGGAAAG---------GTCA GTCAAAATTATCCTATAGTGCAGAAT ; C-ZAM18 ATGGGTGCGAGAGCGTCAATATTAAAAGGGGGAAAATTAGATACATGGGA AAAAATTAGGTTAAGGCCAGGGGGAAAGAAACACTATATGATAAAACACC TAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTAACCCTGGCCTT TTAGAGACATCAGAAGGCTGTAAACAAATAATAAAACAGCTACAACCATC TATTCAGACAGGAACAGAGGAACTTAAATCATTATTCAACACAGTAGTAA CTCTATGGTGTGTACATGAAGATATAACAGTACGAGACACCAAGGAAGCC TTAGACAGGTTAGAGGAAGAACAAAACAAAAGTCAG---CAAAAAACAAA AACACAGCAG---GCAAAAGCGGCTGAC---GGACAG---------GTCA GTCAAAATTACCCTATAGTGCAGAAT ; D-NDK ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATACATGGGA AAGAATTCGGTTACGGCCAGGAGGAAAGAAAAAATATGCACTAAAACATT TGATATGGGCAAGCAGGGAGCTAGAACGATTTACACTTAATCCTGGCCTT TTAGAGACATCAGAAGGCTGTAAACAAATAATAGGACAGCTACAACCATC TATTCAAACAGGATCAGAAGAAATTAGATCATTATATAATACAGTAGCAA CCCTCTATTGTGTACATGAAAGGATAGAGGTAAAAGACACCAAAGAAGCT GTAGAAAAGATGGAGGAAGAACAAAACAAAAGTAAG---AAAAAGACA-- ----CAGCAA---GCAGCAGCT---GATAGC---------AGCCAGGTCA GCCAAAATTACCCTATAGTGCAGAAC ; D-Z2Z6 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTGGATGCATGGGA AAAAATTCGGTTACGGCCAGGAGGAAAGAAAAAATATAGACTAAAACATC TAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCACTTAATCCTGGCCTT TTAGAGACATCAGATGGCTGTAAACAAATAATAGGACAGCTACAACCAGC TATCCGGACAGGATCAGAAGAACTTAGATCATTATTTAATACAGTAGCAA CCCTCTATTGTGTACATGAAAGGATAGAGGTAAAAGACACCAAGGAAGCT TTAGAAAAGATGGAGGAAGAACAAAACAAAAGTAAGAACAAAAAGGCA-- ----CAGCAA---GCAGCAGCT---GACGCAGGGAACAACAGCCAGGTCA GCCAAAATTATCCTATAGTGCAGAAC ; D-ELI ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATAAATGGGA AAAAATTCGGTTACGGCCAGGAGGAAAGAAAAAATATAGACTAAAACATA TAGTATGGGCAAGCAGGGAGCTAGAACGATATGCACTTAATCCTGGCCTT TTAGAAACATCAGAAGGCTGTAAACAAATAATAGGGCAGCTACAACCAGC TATTCAGACAGGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAA CCCTCTATTGTGTACATAAAGGAATAGATGTAAAAGACACCAAGGAAGCT TTAGAAAAGATGGAGGAAGAGCAAAACAAAAGTAAG---AAAAAGGCA-- ----CAGCAA---GCAGCAGCT---GACACAGGAAACAACAGCCAGGTCA GCCAAAATTATCCTATAGTGCAGAAC ; D-94UG114.1 ATGGGTGCGAGAGCGTCAGTATTAAGCGGAGGAAAATTAGATGAATGGGA AAAAATTCGGTTACGGCCAGGGGGAAAGAAAAAATATAGACTAAAACATC TAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCACTTAATCCTGGCCTT TTAGAAACATCAGAAGGCTGTAGACAAATAATAAGACAGCTACAACCATC TATTCAGACAGGATCAGAGGAAATTAAATCATTATATAATACAGTGGTAA CCCTCTATTGTGTACATGAGAGGATAAAGGTAGCAAGCACCAAGGAAGCT TTAGACAAGATAGAGGAAGAACAAGCCAAAAGTAAG---AAAAAAGCA-- ----CAGCAA---GCAACAGCT---GACACAAGAAACAGCAGCCAGGTCA GCCAAAATTATCCTATAGTGCAAAAC ; F-93BR020.1 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCTTGGGA AAAAATTCGGTTAAGGCCGGGGGGAAAGAAAAAATATAGACTAAAACATC TAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCACTTGATCCAGGCCTT CTAGAAACATCAGAAGGCTGTCGAAAAATAATAGGACAGTTACAACCATC CCTTCAGACAGGATCAGAAGAGCTCAAATCATTATATAATACAATAGCAG TCCTCTATTATGTACATCAAAAGGTAGAGGTAAAAGACACCAAGGAGGCT TTAGAGAAGCTAGAGGAAGAACAAAACAAAGGTCGG---CAAAAGACA-- ----CAGCAA---GCGACTGCT---GAAAAAGGG------------GTCA GTCAAAATTACCCTATAGTACAGAAT ; F-BZ162 ATGGGTGCGAGAGCGTCAGTATTAAGCGGAGGAAAACTAGATGCATGGGA AAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAGATTGAAGCATC TAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCAATTAATCCTGGCCTT CTAGAAACATCAGAAGGCTGTCAA-AAATAATAGGACAGTTACAACCATC CCTTCAGACAGGATCAGAAGAGCTTAGATCATTATATAATACAGTAGCAG TCCTCTATTTTGTACATCAAAGGGTAGAGGTAAAGGACACCAAGGAAGCT TTAGACAAGCTAGAGGAAGAACAAAACAAAAGTCAG---CAAAAGACA-- ----AAGCAA---GCGGCAGCT---GACAAAGGG------------GTCA GTCAAAATTACCCTATAGTACAGAAT ; F-VI69 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCATGGGA AAAAATTCGATTAAGACCGGGGGGAAGGAAAAAATACAAAATGAAGCATC TAATATGGGCAAGCAGGGAATTAGAAAGATTTGCACTTGATCCTGGCCTT CTAGAAACATCAGAAGGCTGTAGAAAAATAATAGGACAGTTACAACCATC CCTTCAGACAGGATCAGAAGAGCTTAGATCATTATATAATACAGTAGCAG TTCTCTATTTTGTACATCAAAAGGTAGAGGTAAAGGACACCAAGGAAGCT TTAGAGAAGCTAGAGGAGGAACAAAACAAAAGTCAG---CAAAAGAAA-- ----CAGCAA---GTGGCAGCT---GACAAAGGG------------GTCA GTCAAAATTACCCTATAGTACAAAAT ; F-VI174 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCATGGGA AAAAATTCAGTTAAGGCCGGGGGGGAAGAAAAAATATAGAATGAAGCATC TAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCAATTGATCCTGGTCTT CTAGAAACACCAGAAGGCTGTAGGAAAATAATAGGACAGCTACAAACATC CCTTCAGACAGGATCAGAAGAGCTTAGATCATTGTTTAATACAATAGTAG TCCTCTATTATGTACATCAAAGGGTAGAGATAAAGGACACCAAGGAAGCT TTAGAAAAGCTAGAGGAAGAACAAAACAAAAGTCAG---CAAAAGACA-- ----CAGCAG------GCAGCT---GACAAAGGA------------GTCA GTCAGAATTACCCTATAGTACAAAAT ; G-92NG003.1(g3) ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCATGGGA AAAAATTCGGTTGAGGCCAGGGGGAAAGAAAAAATATAGAATGAAACATT TAGTATGGGCAAGCAGGGAACTGGAGAGATTTGCACTTAACCCTGACCTC TTAGAAACAACAGAAGGTTGTCAGCAAATAATGAGACAGCTGCAACCATC TCTCCAGACAGGAACAGAGGAGATTAAATCATTATTTAATACAGTAGCAA CCCTCTATTGTGTACATCAAAGGATAGAGGTAAAAGACACCAAAGAAGCT CTAGAGGAAGTGGAAAAAATACAAAAGAACAGTCAG---CAAGAAACA-- ----CAGAAG---GCAGCAATG---GGTAAAGGAAACAGCAGCCAAGTTA GCCAAAATTATCCTATAGTGCAGAAT ; G-92NG083.2(jv10832 GTGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATTCTTGGGA AAAAATTCGGTTAAGGCCAGGGGGAAGGAAAAAGTATAAACTAAAACATA TAGTATGGGCAAGCAGGGAACTGGGGAGATTTGCACTTAACCGTGACCTT TTAGAAACAGCAGAAGGTTGTGTGCAAATAATGAAACAGTTGCAACCAGC TCTCTAGACAGGAACAGAGGAGCTTAGATCATTATTTAATACAGTAGCAA CCCTCTACTGTGTACATCAAAAGATAGAGGTAAAAGACACCAAAGAAGCT CCAGAGGAAGTGGAAAAAATACAAAAGAACAGTCAG---CAAGAAATA-- ----CAGCAG---GCAGCAAAG---AATGAAGGAAACAGTAACCCAGTCA GCCAAAATTATCCTATAGTGCAGAAT ; H-90CR056.1(u40561) ATGGGTGCGAGAGCGTCAGTATTAAGCGGCGGAAAATTAGATGCTTGGGA GAAAATTCGGCTAAGGCCAGGGGGAAAGAAAAAATATAGGCTAAAACATC TAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTAACCCCGGCCTT TTAGAAACACCAGAAGGCTGTCTACAGATAATAGAACAGATACAGCCAGC TATTAAGACAGGAACAGAAGAACTTAAATCATTATTTAATCTAGTAGCAG TCCTCTATTGCGTACATCGAAAAATAGATGTGAAAGACACCAAGGAGGCT TTAGATAAGATAGAGGAAATACAAAACAAAAGTCAG---CAAAAAACA-- ----CAGCAA---GCAGCAGCT---GATAAGGAAAAAGACAACAAGGTCA GTCAAAATTATCCTATAGTACAGAAT ; H-VI557 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCATGGGA GAAAATTCGGTTGAGGCCAGGGGGAAAGAAAAAATATAGACTGAAACATT TAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTCAACCCCGACCTT TTAGACACAGCAGAAGGCTGTCTACAATTAATAGAACAGCTACAACCAGC TCTTAAGACAGGAACAGAAGAACTTCAATCATTATTTAATCTATTAGCAA CCCTCTATTGCGTACATCAAAGAATAGATGTAAAAGACACCAAGGAAGCT TTAGAGAAGTTAAAGGAGGCACAAAACAAAAGCCAG---AACAGGACA-- ----CAGCAG---GCAACAGGT---GATAAAGGAAATGGCAACAAGATCA GTCAAAATTATCCTATAGTACAAAAT ; SE7022 ATGGGTGCGAGAGCGTCAATATTARGTGGGGGAAAATTAGATGATTGGGA AAAAATTCGGTTGAGGCCAGGGGGGAAGAAACAATATAGGATAAAACATC TAGTATGGGCAAGCAGGGAGCTGGACAGATTTGCACTTAACCCTGGCCTT CTAGAGTCAGCAAAAGGCTGTCAACAAATACTAGTACAGCTCCAACCAGC TCTTCAGACAGGAACAGAAGAAATTAAATCATTGTATAATACAGTAGCAA CCCTCTATTGCGTACATCAGAGGATAGAGATAAAAGACACCACGGAAGCT TTAGAGAAGATAGAGGRAATTCAAAACAAAAACAAA---CAGCAGGCA-- ----CAGAAA---GCAGAAACT---GACAAAAAAGACAACAGTCAGGTCA GTCAAAATTATCCTATAGTGCAGAAT ; SE7887 ATGGGTGCGAGAGCGTCAATATTAAGTGGGGGAAAATTAGATGATTGGGA AAAAATTCGGTTGAGGCCAGGGGGGAAGAAACAATATAGGATAAAACATC TAGTATGGGCAAGCAGGGAGCTGGACAGATTTGCACTTAACCCTGGCCTT CTAGAGTCAGCAAAAGGCTGTCAACAAATACTAGTACAGCTCCAACCAGC TCTTCAGACAGGAACASAAGAAATTAAATCATTGTATAATACAGTAGCAA CCCTCTATTGCGTACATCAGAGGATAGAAATAAAAGACACCACGGAGGCT TTAGAGAAGATAGAGGAAATTCAAAACAAAAACAAA---CAGCAGGCA-- ----CAGAAA---GCAGAAACT---GACAAAAAAGACAACAGTCAGGTCA GTCAAAATTATCCTATAGTGCAGAAT ; O-ANT70 ATGGGTGCGAGTGCGTCTGTGTTGACAGGAAGCAAATTGGATGCATGGGA ACAAATTAGGTTAAAGCCAGGATCTAAAAAGAAATATAGACTAAAACACT TAGTATGGGCAAGCAGAGAGCTGGAAAGATTCGCATGTAATCCTGAGCTA CTAGAAACTGCAGAGGGTAATGAGAAGCTGCTACAGCAGTTAGAGCCAGC TCTCAAGACAGGGTCAGACAGCCTGCAGTCACTCTGGAACGCAATAGTAG TGCTCTGGTGTGTTCACAACAGATATAAAATTGGAGATACGCAGCAGGCA ATACAAAAGTTAAAGGAAGTA---ATGGGGAGCAGG---AAGTCTGCG-- -------GAC------GCCGCTAAGGAAGACACAAGCGCAAGGCAGGCGG GTCAAAATTACCCTATAGTATCAAAT ; O-MVP5180 ATGGGTGCGAGAGCGTCTGTGTTGACAGGGAGTAAATTGGATGCATGGGA ACGAATTAGGTTAAGGCCAGGATCTAAAAAGGCATATAGGCTAAAACATT TAGTATGGGCAAGCAGGGAGCTGGAAAGATACGCATGTAATCCTGGTCTA TTAGAAACTGCAGAAGGTACTGAGCAACTGCTACAGCAGTTAGAGCCAGC TCTCAAGACAGGGTCAGAGGACCTGAAATCTCTCTGGAACGCAATAGCAG TACTCTGGTGCGTTCACAACAGATTTGACATCCGAGATACACAGCAGGCA ATACAAAAGTTAAAGGAAGTA---ATGGCAAGCAGG---AAGTCTGCA-- -------GAG------GCCGCTAAGGAAGAAACAAGCCCTAGGCAGACAA GTCAAAATTACCCTATAGTAACAAAT ; CPZGAB ATGGGTGCGAGAGCGTCAGTTCTAACAGGGGGAAAATTAGATCGCTGGGA AAAAGTTCGGCTTAGGCCCGGGGGAAGAAAAAGATATATGATGAAACATT TAGTATGGGCAAGCAGGGAGCTGGAAAGATTCGCATGTGACCCCGGGCTA ATGGAAAGTAAGGAAGGATGTACTAAATTGTTACAACAATTAGAGCCAGC TCTCAAAACAGGCTCAGAAGGACTGCGGTCCTTGTTTAACACTCTGGCAG TACTGTGGTGCATACATAGTGACATCACTGTAGAAGACACACAGAAAGCT CTAGAACAGCTAAAGCGGCATCATGGAGAACAACAG---AGCAAAACT-- ----GAAAGTAACTCAGGAAGC---CGTGAAGGGGGAGCCAGTCAAGGCG CTAGTGCCTCTGCTGGCATTAGTGGA ; CPZANT ATGGGAGCGGGGGCGTCTGTTTTGAGGGGAGAGAAGCTAGATACATGGGA AAGTATCAGGCTTCGGCCCGGTGGCAAGAAAAAGTACATGATAAAACATC TGGTTTGGGCAAGATCGGAGCTGCAGCGTTTTGCGCTCAGCTCCTCCCTT CTAGAAACATCAGAAGGTTGTGAAAAGGCTATCCATCAATTGAGCCCTTC CATAGAAATAAGATCCCCTGAAATAATATCTTTGTTTAACACCATTTGTG TTCTGTGGTGCGTACATAAAGGGGAAAAGATAAAAGACACAGAACAAGCC GTTAAAACAGTGAAAATGAAAGTAATGCAGACACAA---GCAGAAACA-- ----GGAAGT---AGCCAAACC---GCAAGCAGAGGCATGCTTCTGCGGC TGCTCCTGTTAAACAAACAGTGGTGT
last modified: Fri Aug 10 14:02 2007


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health