HIV Databases HIV Databases home HIV Databases home
HIV sequence database



; A-U455 ATGGGTGGCAAGTGGTCAAAAAAGAGCAGAGTGGAATGGCCTGAGGTTAGGAAAAGAATGAGAGAAACTC CT---------------------------------GCAGCAGCAAAAGGAGTAGGAGCAGTATCTCAA-- -------------GATTTAGATAAATATGGAGCAGTCACAAGCAGTAATACATCATCTACTAATGCCAGT TGTGCCTGGCTGGAAGCGCAAGAGGAAGGA------GACGTAGGCTTCCCAGTTAGGCCACAGGTACCTT TAAGACCAATGACTTATAAGGCAGCTTTTGATCTCAGCTTCTTTTTAAAAGAAAAGGGGGGACTGGATGG GTTAATTCACTCACAGAAAAGACAAGAAATCCTTGATCTGTGGGTCTATCACACACAAGGATTCTTCCCT GATTGGCAGAATTACACACCAGGGCCAGGAATCAGATACCCACTAACATTTGGATGGTGCTACAAGCTAG TACCAGTTGATCCAGCTGAAGTAGAGGAA---GCTACTGGAGGAGAGAACAACAGTCTACTACACCCTAT ATGCCAACATGGAGTAGATGATGAAGAGAAAGAAGTGTTAATGTGGAAGTTTGACAGTACCCTGGCATTA AAACACAGAGCTTATGAGCTGCATCCGGAGTTCTAT---AAAGAC---TGA--- ; A-92UG037.1 ATGGGTAACAAGTGGTCAAAGAGTTGCATAGTGGGATGGCCTGAGGTTAGGGAAAGAATAAGACAAACTC CTACAGCAGCAAGGGAAAGAACAAGACAAGCCCCTACAGCAGCAAAAGGAGTAGGAGCAGTATCTCAA-- -------------GATTTAGATAAACATGGAGCAGTCACAAGCAGCAATGTA------AATCACCCTAGT TGCGTCTGGCTGGAAGCGCAGGAGGAAGAA------GAGGTAGGCTTTCCAGTCAGACCACAGGTACCTC TAAGGCCAATGACTTACAAGGCAGCTTTCGATCTCGGCTTCTTTTTAAAAGAAAAGGGGGGACTGGATGG GTTAATTTACTCCAAGAAAAGACAAGAAATCCTTGATCTGTGGGTCTACCACACACAAGGCTACTTCCCT GATTGGCAGAATTACACACCAGGGCCAGGGATCAGATACCCACTAACATTTGGATGGTGCTTCAAGCTAG TACCAGTGGATGAAGATGAAGTAGAGGAA---GCTACTGGAGGAGAGAACAATAGCCTATTACACCCTAT ATGCCAACATGGAATGGATGATGAGGAGAAAGAAACATTAAGGTGGAAGTTTGACAGCAGCCTGGCACGA GTACACAAAGCAAGAGAGCTGCATCCGGAGTTTTAC---AAAGACTGCTGA--- ; B-HXB2 ATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGGCCTACTGTAAGGGAAAGAATGAGACGAGCTG AG---------------------------------CCAGCAGCAGATAGGGTGGGAGCAGCATCTCGA-- -------------GACCTGGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTACCAATGCTGCT TGTGCCTGGCTAGAAGCACAAGAGGAGGAG------GAGGTGGGTTTTCCAGTCACACCTCAGGTACCTT TAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGG GCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCT GATTAGCAGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAG TACCAGTTGAGCCAGATAAGATAGAAGAG---GCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGT GAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTT CATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTC---AAGAACTGCTGA--- ; B-JRFL ATGGGTGGCAAGTGGTCAAAACGTAGTGTGCCTGGATGGTCTACTGTAAGGGAAAGAATGAGACGAGCTG AGCCAGCAGCAGATAGGGTGAGACGA---ACTGAGCCAGCAGCAGTAGGGGTGGGAGCAGTATCTCGA-- -------------GACCTGGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTACCAATGCTGAT TGTGCCTGGCTAGAAGCACAAGAGGATGAG------GAAGTGGGTTTTCCAGTCAGACCTCAGGTACCTT TAAGACCAATGACTTACAAGGGAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGG GCTAATTCACTCACAGAAAAGACAAGATATCCTTGATCTGTGGGTCTACCACACACAAGGCTACTTCCCT GATTGGCAGAACTACACACCAGGGCCAGGAATCAGATTTCCATTGACCTTTGGATGGTGCTTCAAGCTAG TACCAGTTGAGCCAGAAAAGGTAGAAGAG---GCCAATGAAGGAGAGAACAACTGCTTGTTACACCCTAT GAGCCAGCATGGGATAGAGGACCCGGAGAAGGAAGTGTTAGAGTGGAGGTTTGACAGCAAGCTAGCATTT CATCACGTGGCCCGAGAGCTGCATCCGGAGTACTAC---AAGGACTGCTGAC-- ; B-OYI ATGGGTGGCAAGTGGTCAAAATGTAGTATGAAGGGATGGCCTACTATAAGGGAAAGAATGAAGCGAGCTG AGCTACAGCCA------------------CCTGAGCCAGCAGCAGAAGGGGTGGGAGCAGCATCTCGA-- -------------GACCTGGAAAAACATGGAGCAATCACTAGTAGCAATACAGCAGCTACTAATGCTGAT TGTGCCTGGCTAGAAGCACAAGAGGATGAA------GAGGTGGGTTTTCCAGTCAGACCTCAGGTACCTT TAAGACCAATGACTTACAAGGGAGCTTTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGG GCTAATTTACTCCCAGAAAAGACAAGATATTCTTGATCTGTGGGTCTATCACACACAAGGCTATTTCCCT GATTGGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGTGCTTTGGATGGTGCTTCAAGTTAG TACCAATGGATCCAGACCAGGTAGAAGAG---GCCAACGAAGGAGAGAACAACAGCTTGTTACATCCTAT AAGCCTGCATGGGATGGATGACCCAGAGAAAGAAGTGTTAGTGTGGAAGTTTGACAGCCGCCTAGCATTT CGTCACATGGCCCGAGAGGTGCATCCGGAGTACTAC---AAAGACTGCTGA--- ; B-RF ATGGGTGGCAAGTGGTCAAAAAGTAAGATGGGTGGATGGCCTGCTGTAAGGGAAAGAATGCAAAAAGCTG AG---------------------------------CCAGCAGCAGATGGGGTGGGAGCAGCATCTCGA-- -------------GACCTGGAGAAACATGGAACAATCACAAGTAGCAATACAGCAGCTAATAATGCTGCT TGCACCTGGCTAGAAGCACAAGAGGATGAGGATGAGGAGGTGGGTTTTCCAGTCAGACCTCAGGTACCTT TAAGGCCTATGACTTTCAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGATGG GCTAGTGTTCTCCCAGAAAAGACAAGATATCCTTGATCTGTGGGTTTACCACACACAAGGCTACTTCCCT GACTGGCAGAACTACACACCAGGGCCAGGGACCAGATATCCACTGACCTTTGGATGGTGCTTCAAGCTAG TACCAGTTGAGCCAGATAAGGTAGAAGAG---GCCACTGAAGGAGAGAACAACAGCTTGTTACACCCTAT ATGCCTGCATGGGATGGATGACCCAGAGAAAGAAGTGTTAGTGTGGAAGTTTGACAGCCGCCTCGCATTT CATCACGTCGCCCGAGAGAAGCATCCGGAGTACTAC---AAAGACTGCTGA--- ; C-ETH2220 ATGGGGGGCACGATGTCAAAATGTAGTCCAGTAGGATGGCCTGCTATAAGAGAAAGAATAAGACGAGCTG CT---------------------------------CCAGCAGCAGAGGGAGTAGGAGCAGCGTCTCGA-- -------------GACTTAGACAAATATGGGGCACTTACAAGCAGCAACACACCCGCCAATAATCCTGAT TGTGCCTGGCTGGAAGCGCAAGAGGAGGAA---GAAGAGGTAGGCTTTCCAGTCAGACCTCAGGTACCTT TAAGACCAATGACTTATAAGGCAGCATTCGATCTCAGCCTCTTTTTAAAAGAAAAGGGGGGACTGGAAGG GTTAATTTACTCCAAGAAAAGGCAGGAGATTCTTGATTTGTGGGTCTATAACACACAAGGCTTCTTCCCT GATTGGCAAAACTACACACCAGGACCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTTCAAGCTAG TACCAGTTGACCCAAGTGAAGTGGAAGAA---ATCAATGAAGGAGAGAACAACTGCTTGCTGCACCCTGC GAGCCTGCATGGAATGGAGGATGAAGACAGAGAAGTATTAAAGTGGAAGTTTGACAGTCACCTAGCACGC AGACACATGGCCCGCGAGCTACATCCGGAGTATTAC---AAAGACTGCTGA--- ; C-92BR025.8 ATGGGGAACAAATGGTCAAAATGTAGTACAGTGGGACGGCCTGCTATAAGAGAAAGAATGAGACGAGCT- -----------------------------------CCAGCAGCAGAGGGAGTAGGACCAGCGTCTCAA-- -------------GACTCAGATAAATACGGGGCACTGACAAGCAGCAGCACACCTGCCAATAATGCTGAT TGTGCCTGGCTGGAAGCGCAACAGGAGGAA---GAAGAGGTAGGCTTTCCAGTCAGACCTCAGGTACCTT TAAGACCAATGACTTATAAGGCAGTAGTCGATCTCAGCTTCTTTTTAGAAGAAAAGGGGGGACTGGAAGG GTTAATTTACTCTAAGAAAAGGCAAGACATCCTTGATTTGTGGGTCTATAACACACAAGGCTACTTTCCT GATTGGCAAAACTACACACCAGGACCAGGGGTCAGGTTTCCCCTGACCTTTGGATGGTGCTTCAAGCTAG TGCCAGTTGACCCAAGGGAAGTGGAAGAG---GCCAATACAGGAGAGAACAACAGCTTACTACACCCTAT GAGCCTGCATGGAATGGAGGATTCACACAGAGAAGTATTACAGTGGAAGTTTGACAGTCTCCTAGCACGT AGACACATGGCCCGCGAGCTACATCCGGAGTATTAC---AAAGACTGCTGA--- ; D-NDK ATGGGTGGCAAATGGTCAAAAAGTAGTTTAGTTGGATGGCCTGCTATAAGGGAAAGAATAAGAAAAACTG AT---------------------------------CCAGCAGCAGATGGGGTAGGAGCAGTATCTCGA-- -------------GACCTGGAAAAACATGGGGCAATCACAAGTAGCAATACAGCAAGTACTAATGATACC TGTGCATGGCTGGAAGCACAAGAGGAGAGC---GAGGAGGTGGGCTTTCCAGTTAGACCTCAGGTACCTT TAAGACCAATGACTTACAAAGAAGCTGTTGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGG GCTAATTTGGTCCAAGAAAAGACAAGAGATCCTTGATCTTTGGGTCTACAACACACAAGGCATCTTCCCC GATTGGCAGAACTACACACCAGGGCCAGGGATCAGATACCCACTGACCTTTGGATGGTGCTTCCAGCTAG TACCAGTTGATCCACAGGAGGTAGAAGAG---GCCACTGAAAGAGAGGACAACTGCTTGTTACACCCTAT GTGCCAGCAAGGAATGGAGGACCCGGAGAGACAAGTGTTAATGTGGAGATTTAACAGCAGACTAGCACTT GAGCACAAGGCCCGAGAGCTGCATCCGGAGTTCTAC---AAAGACTGCTGA--- ; D-Z2Z6 ATGGGTGGCAGATGGTCAAAAAGTAGTATAGTTGGATGGCCTGCTATAAGGGAAAGAATAAGAAGAACTG AT---------------------------------CCAGCAGCAGATGGGGTAGGAGCAGTATCTCGA-- -------------GACCTGGAAAAACATGGGGCAATCACAAGTAGCAATACAAGGGGTACTAATGCTGAC TGTGCCTGGCTAGAAGCACAAGAAGAGAGC---GAGGAGGTGGGCTTTCCAGTCAGACCTCAGGTACCTT TAAGACCAATGACTTACAAAGGAGCGTTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGAC------- ---------------------------------------------------------------------- ---------------------------------------------------------------------- ---------------------------------------------------------------------- ---------------------------------------------------------------------- ------------------------------------------------------ ; D-ELI ATGGGTGGCAAATGGTCAAAAAGTAGTATAGTGGGATGGCCTGCTATAAGGGAAAGAATAAGAAGAACTA AT---------------------------------CCAGCAGCAGATGGGGTAGGAGCAGTATCTCGA-- -------------GACCTGGAAAAACATGGGGCAATCACAAGTAGCAATACAGCAAGTACTAATGCTGAC TGTGCCTGGCTAGAAGCACAAGAAGAGAGC---GACGAGGTGGGCTTTCCAGTCAGACCCCAGGTACCTT TAAGACCAATGACTTACAAAGAAGCTCTAGATCTCAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGG GCTAATTTGGTCCAAAAAGAGACAAGAGATCCTTGATCTTTGGGTCTACAACACACAAGGCATCTTCCCT GATTGGCAAAACTACACACCAGGGCCAGGGATCAGATATCCACTAACCTTTGGATGGTGCTACGAGCTAG TACCAGTTGATCCACAGGAGGTAGAAGAA---GACACTGAAGGAGAGACCAACAGCTTGTTACACCCTAT ATGCCAGCATGGAATGGAGGACCCGGAGAGACAAGTGTTAAAATGGAGATTTAACAGCAGACTAGCATTT GAGCACAAGGCCCGAGAGATGCATCCGGAGTTCTAC---AAAAACTGATGA--- ; D-94UG114.1 ATGGGTGGCAAGTGGTCAAAAAGTAGTATAGTTGGGTGGCCTGCTGTAAGAGAAAGAATGAGAAGAACTG AG---------------------------------CCAGCAGCAGAAGGGGTGGGAGCAGCATCCCGG-- -------------GACCTGGAAAAACATGGGGCAATCACAAGCAGCAATACAGCACAGACTAATGATGCC TGTGCCTGGCTAGAAGCACAGGAAGAGGAG------GAAGTGGGATTTCCAGTCAGACCTCAGGTACCAT TAAGACCAATGACTTACAAGGAAGCGGTAGACCTAAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGG GTTAGTTTGGTCCCCGAAAAGACAAGAGATCCTTGATCTTTGGGTCTACCACACACAAGGCTTCTTCCCT GATTGGCAAAATTACACACCAGGGCCAGGGATTAGATATCCACTGACCTTTGGATGGTGCTTCGAGTTAG TACCAATGGAGCCAAAGGAGGTAGAAGAG---AACACTGAAGGAGAGGACAACTGCTTGTTACACCCGAT AAACCAGCATGGAATGGAGGACCCGGAGAGAGAAGTTTTAGTGTGGAGATTTAACAGCAGACTAGCATTT GAACACAAGGCCAAAATGAAACATCCGGAGTACTAC---AAAGACTGCTGA--- ; F-93BR020.1 ATGGGTGGCAAGTGGTCAAAAAGTAGTATAGTTGGATGGCCTGCTATAAGGGAAAGAATGAGGCGAACCC CTCCAACC------------------------CCTCCAGCAGCAGAGGGGGTGGGAGCAGTGTCTCAA-- -------------GACTTAGAAAGACGGGGGGCAATTACAAGCAGCAATACTAGAGCTAATAATCCTGAC TTGGCCTGGCTGGAAGCACAAGAGGAAGAC------GAAGTAGGCTTTCCAGTCAGACCTCAGGTACCTT TAAGACCAATGACCTATAAGGGAGCTGTAGATCTCAGTCACTTTTTAAAAGAAAAGGGGGGACTGGAAGG GTTAATTTACTCCAAGAGAAGACAAGAGATCCTTGATCTGTGGGTCTACCACACACAAGGCTACTTCCCT GATTGGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCATGGGGTGGTGCTTCAAGCTAG TACCAGTTGACCCAGAGGAGGTAGAAAAG---GCCAATGAAGGAGAGAACAACTGCTTGCTACACCCCAT GAGCCAACATGGAATGGAGGATGAAGACAAAGAAGTACTGAAATGGGAGTTTGACAGCCGCTTGGCACTG AGACACATAGCCAGAGAGAGACATCCGGAGTACTAC------CAAGACTGA--- ; G-92NG003.2(g3) ATAGGAGGCAAGTGGTCAAAAAGTAGCATAGTTGGATGGCCCGCGGTAAGGGAGAGAATAAGACAAACC- -----------------------------------CCTCCAGCAGAAGGAGTAGGAGCAGCACCTCAA-- -------------GACTTAGCTAGGCATGGAGCAATCACAAGCAGCAATACAGCACAAACTAATCCTGAT TGTGCCTGGCTAGAAGCACAACAGGAGAAT---TCAGAGGTAGGCTTTCCAGTCAGACAACAGGTACCTT TGAGACCAATGACTTATAAGGCTGCCTTTGATCTCAGCTTCTTTTTAAAAGAAAAGGGGGGACTGGATGG GCTAATTTACTCTAAGAAAAGACAAGACATCCTTGACCTATGGGTCTATAATACACAAGGATACTTCCCA GATTGGCAGAACTACACTCCAGGGCCAGGGACTAGATTCCCACTGACATTTCGGTGGTGCTTCAAACTAG TACCAATGGATCCAGCAGAGATAGAGGAA---GCCAATAAAGGAGAGAACAACAGTTTATTACACCCTAT CTGCCAACATGGCCTGGAAGATGCGGACAGAGAAGTGCTGGTATGGAGATTTGACAGTAGCCTAGCACGG AGACACATAGCCCGAGAACAACATCCGGAGTACTAT---AAGGACTGCTGA--- ; G-92NG083.1(jv10832 ATGGGGGGCAAGTGGTCAAAAAGTAGCATAGTTGGATGGCCTCAGATAAGGGAAAGAATAAGACAAACTC CT---------------------------------GTAGCAGCAGAAGGAGTAGGAGCAGTATCTCAA-- -------------GATTTAGCTAGGCATGGAGCAATCACAAGCAGCAATACAGCAACCAACAATCCTGAT TGTGCCTGGCTGGAAGCACAAGAGGAGGAC---TCAGATGTAGGCTTTCCGGTCAGACCACAGGTACCTT TGAGACCAATGACTTATAAGGCTGCTTTTGATCTCAGCTTCTTTTTAAAAGAAAAGGGGGGACTGGATGG GCTAATTTACTCCAAGAGAAGACAAGACATCCTTGATCTATGGGTCTATAATACACAAGGATTCTTCCCA GATTGGCAGAACTACACACCAGGGCCAGGGACTAGACTCCCACTGACCTTTGGGTGGTGCTTCAAACTAG TACCAATGGACCCAGCAGAGATAGAGGAA---GCCAATAAGGGAGAGAACATCAGTCTATTACACCCCAT CTGCCAGCATGGAATGGAGGATGAAGACAGAGAAGTGCTGGTATGGAGATTTAACAGTAGCCTAGCACGG AGACACCTAGCCCGAGAGCTGCATCCGGAGTACTAC---AAAGACTGCTGA--- ; H-90CR056.1(u40561) ATGGGAGGCAAATGGTCAAAAAGTAGGATGGGTGGGTGGTCTACTATAAGGGAAAGAATGAGGCGAGCTG AA---------------------------------CCAGTAGCAGAAGGGGTAGGAGCAGTGTCTCGA-- -------------GATTTGGATAGACGCGGGGCAGTCACAATTAATAATACAGCATCTACTAATCGTGAT GCCGCCTGGCTGGAAGCACAAGAGGACGGG---GAGGAAGTAGGCTTTCCAGTCAGGCCTCAGGTACCTT TAAGACCAATGACCTATAAGGGAGCTTTTGATCTCAGCCATTTTTTAAAAGAAAAGGGGGGACTGGATGG GTTAATTTACTCCAAGCAAAGACAGGACATCCTTGATTTATGGGTCTATAACACACAAGGCTACTTCCCT GACTGGCAGAACTACACACCAGGGCCAGGGGAGAGATTTCCCCTGACCTTTGGGTGGTGCTTCAAGCTAG TACCAGTAAATCCACAGGAGGTAGAACAG---GCCAATGAAGGAGAGAACAACAGCTTGCTACACCCCAT GAGCCTGCATGGAATGGAGGATGACGGGAGAGAAGTGCTGATGTGGAAATTTGACAGTCGACTAGCATTG ACACACTTGGCCCGAGTAAAGCATCCGGAGTAC------AAAGACTGCTGA--- ; O-ANT70 ATGGGAAACGCATTGAGAAAAGGTAAATTTGAGGGATGGGCAGCAGTAAGAGAAAGAATGAGAAGAACTA GAACTTTCCCTGAG---------------TCTGAACCATGCGCACCTGGAGTAGGACAGATCTCCAGG-- -------------GAATTAGCAGCTAGAGGAGGGATACCAAGTTCCCATACTCCTCAAAACAATGCAGCC CTTGCATTCCTAGAAAGTCACCAAGAGGAA------GAAGTAGGTTTTCCAGTAGCACCTCAAGTGCCTC TAAGGCCAATGACCTATAAAGGAGCATTTGACCTCAGCTTCTTTTTAAAAGAAAAGGGAGGACTGGAAGG GTTAATTTACTCCCATAAAAGAGCAGAAATCCTGGATCTTTGGGTGTATAACACTCAGGGATTCTTCCCT GATTGGCAGAACTACACACCAGGACCAGGAACCAGGTTCCCACTGACATTTGGATGGTTGTTTAAACTAG TACCAGTGTCAGAAGAAGAGGCAGAAAGACTAGGAAATACATGTGAGAGGGCTAATCTCCTGCATCCAGC ATGTGCCCATGGATTTGAAGATACACATAAAGAAATACTGATGTGGAAGTTTGATAGATCTCTAGGCAAC ACCCATGTTGCTATGATAACTCACCCAGAGCTCTTCCAGAAGGAC---TAA--- ; O-MVP5180 ATGGGGAATGCATGGAGCAAAAGCAAATTTGCAGGATGGTCAGAAGTAAGAGATAGAATGAGACGATCCT CCTCTGATCCTCAA------------------CAACCATGTGCACCTGGAGTAGGAGCTGTCTCCAGG-- -------------GAGTTAGCAACTAGAGGGGGAATATCAAGTTCCCACACTCCTCAAAACAATGCAGCC CTTGCATTCCTAGACAGCCACAAAGATGAG------GATGTAGGCTTCCCAGTAAGACCTCAAGTGCCTC TAAGGCCAATGACCTTTAAAGCAGCCTTTGACCTCAGCTTCTTTTTAAAAGAAAAGGGAGGACTGGATGG GTTAATTTACTCCCATAAGAGAGCAGAAATCCTGGATCTCTGGATATATCACACTCAGGGATTCTTCCCT GATTGGCAGTGTTACACACCGGGACCAGGACCTAGATTCCCACTGACATTTGGATGGTTGTTTAAACTGG TACCAGTGTCAGCAGAAGAGGCAGAGAGACTGGGTAATACAAATGAAGATGCTAGTCTTCTACATCCAGC TTGTAATCATGGAGCTGAGGATGCACACGGGGAGATACTAAAATGGCAGTTTGATAGATCATTAGGCTTA ACACATATAGCCCTGCAAAAGCACCCAGAGCTCTTCCCCAAG------TAA---
last modified: Fri Aug 10 14:02 2007


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health