HIV Databases HIV Databases home HIV Databases home
HIV sequence database



; O-ANT70 ATGGGTGCGAGTGCGTCTGTGTTGACAGGAAGCAAATTGGATGCATGGGAACAAATTAGGTTAAAGCCAG GATCTAAAAAGAAATATAGACTAAAACACTTAGTATGGGCAAGCAGAGAGCTGGAAAGATTCGCATGTAA TCCTGAGCTACTAGAAACTGCAGAGGGTAATGAGAAGCTGCTACAGCAGTTAGAGCCAGCTCTCAAGACA GGGTCAGACAGCCTGCAGTCACTCTGGAACGCAATAGTAGTGCTCTGGTGTGTTCACAACAGATATAAAA TTGGAGATACGCAGCAGGCAATACAAAAGTTAAAGGAAGTA---ATGGGGAGCAGG---AAGTCTGCG-- -------GAC------GCCGCTAAGGAAGACACAAGCGCAAGGCAGGCGGGTCAAAATTACCCTATAGTA TCAAATGCGCAGGGACAAATGGTACATCAGGCCATCTCCCCCAGGACTTTAAATGCATGGGTAAAGGCAG TAGAAGAAAAAGCCTTTAACCCTGAAATCATTCCTATGTTCATGGCATTGTCAGAGGGAGCAATTTCCTA TGATATTAATACTATGCTAAATGCCATAGGAGGACATCAAGGAGCTTTACAAGTGCTAAAGGAAGTAATC AATGAGGAAGCAGTAGAGTGGGATAGAACTCACCCACCACCGGTAGGGCCGTTGCCACCAGGGCAGATAA GGGAACCAACAGGAAGTGACATTGCTGGGACAACTAGCACCCAGCAAGAGCAAATTCACTGGACTACCAG GCCCAACCAACCTATCCCAGTAGGAGACATCTATAGAAAATGGATAGTGTTAGGACTAAACAAAATGGTA AAAATGTACAGCCCAGTGAGCATCTTAGATATTAAGCAGGGACCAAAGGAACCATTTAGAGACTATGTAG ATCGGTTCTACAAAACATTAAGAGCTGAGCAAGCTACTCAAGAAGTAAAAAATTGGATGACAGAAACTCT GCTTGTTCAAAATGCCAATCCAGATTGCAAACAGATTTTGAAATCATTAGGGCCAGGAGCTACCTTAGAA GAGATGATGGTAGCCTGTCAGGGAGTAGGAGGACCAACTCATAAGGCCAGAGTGCTAGCAGAAGCAATGG CTACAGCC---CAGCAAGATTTGAAAGGAGGATACACAGCAGTATTCATGCAAAGAGGGCAA---AATCC AATTAGGAAAGGAACTATAAAATGTTTCAACTGTGGAAAAGAGGGACATATAGCAAGAAATTGTCGAGCA CCTAGGAAAAAGGGTTGCTGGAAATGTGGACAGGAAGGTCACCAAATGAAAGATTGCAGAAAT---GGAA AACAGGCAAATTTTTTAGGCAAATACTGGCCTCCGGGGGGCACGAGGCCAGGCAATTATGTGCAGAGACC AGCA------CACCCATCAGCCCCACCGATGGAG---------------------------------GAG GAAGTGAAGGGACAGGAGAAT------------CAGGAACAGAAAGGG---GGCCCGAACGAGCTC---T AT---CCGTTTGCCTCCCTCAAATCCCTCTTTGGGACAGAC---------CAATAG ; O-MVP5180 ATGGGTGCGAGAGCGTCTGTGTTGACAGGGAGTAAATTGGATGCATGGGAACGAATTAGGTTAAGGCCAG GATCTAAAAAGGCATATAGGCTAAAACATTTAGTATGGGCAAGCAGGGAGCTGGAAAGATACGCATGTAA TCCTGGTCTATTAGAAACTGCAGAAGGTACTGAGCAACTGCTACAGCAGTTAGAGCCAGCTCTCAAGACA GGGTCAGAGGACCTGAAATCTCTCTGGAACGCAATAGCAGTACTCTGGTGCGTTCACAACAGATTTGACA TCCGAGATACACAGCAGGCAATACAAAAGTTAAAGGAAGTA---ATGGCAAGCAGG---AAGTCTGCA-- -------GAG------GCCGCTAAGGAAGAAACAAGCCCTAGGCAGACAAGTCAAAATTACCCTATAGTA ACAAATGCACAGGGACAAATGGTACATCAAGCCATCTCCCCCAGGACTTTAAATGCATGGGTAAAGGCAG TAGAAGAGAAGGCCTTTAACCCTGAAATTATTCCTATGTTTATGGCATTATCAGAAGGGGCTGTCCCCTA TGATATCAATACCATGCTGAATGCCATAGGGGGACACCAAGGGGCTTTACAAGTGTTGAAGGAAGTAATC AATGAGGAAGCAGCAGAATGGGATAGAACTCATCCACCAGCAATGGGGCCGTTACCACCAGGGCAGATAA GGGAACCAACAGGAAGTGACATTGCTGGAACAACTAGCACACAGCAAGAGCAAATTATATGGACTACTAG AGGGGCTAACTCTATCCCAGTAGGAGACATCTATAGAAAATGGATAGTGCTAGGACTAAACAAAATGGTA AAAATGTACAGTCCAGTGAGCATCTTAGATATTAGGCAGGGACCAAAAGAACCATTCAGAGATTATGTAG ATCGGTTTTACAAAACATTAAGAGCTGAGCAAGCTACTCAAGAAGTAAAGAATTGGATGACAGAAACCTT GCTTGTTCAGAATTCAAACCCAGATTGTAAACAAATTCTGAAAGCATTAGGACCAGAAGCTACTTTAGAA GAAATGATGGTAGCCTGTCAAGGAGTAGGAGGGCCAACTCACAAGGCAAAAATACTAGCAGAAGCAATGG CTTCTGCC---CAGCAAGATTTAAAAGGAGGATACACAGCAGTATTCATGCAAAGAGGGCAG---AATCC AAATAGAAAAGGGCCCATAAAATGCTTCAATTGTGGAAAAGAGGGACATATAGCAAAAAACTGTCGAGCA CCTAGAAAAAGGGGTTGCTGGAAATGTGGACAGGAAGGTCACCAAATGAAAGATTGCAAAAAT---GGAA GACAGGCAAATTTTTTAGGGAAGTACTGGCCTCCGGGGGGCACGAGGCCAGGCAATTATGTGCAGAAACA AGTG------TCCCCATCAGCCCCACCAATGGAG---------------------------------GAG GCAGTGAAGGAACAAGAGAAT------------CAGAGTCAGAAGGGG---GATCAGGAAGAGCTG---T AC---CCATTTGCCTCCCTCAAATCCCTCTTTGGGACAGAC---------CAATAG ; A-U455 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGAAAAAATTAGATTCATGGGAGAAAATTCGGTTAAGGCCAG GGGGAAACAAAAAATATAGACTGAAACATTTAGTATGGGCAAGCAGGGAGCTGGAAAAATTCACACTTAA CCCTGGCCTTTTAGAAACAGCAGAAGGATGTCAGCAAATACTGGGACAATTACAACCAGCTCTCCAGACA GGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAGTCCTCTATTGTGTACATCAAAGGATAGATG TAAAAGACACCAAGGAAGCTTTAAATAAAATAGAGGAAATGCAAAATAAGAACAAG---CAAAGGACA-- ----CAGCAG---GCAGCAGCT---AACACAGGA------AGC------AGTCAAAATTACCCCATAGTG CAAAATGCACAAGGGCAACCAGTACACCAGGCCTTATCACCTAGGACCTTGAATGCATGGGTGAAAGTAG TAGAAGACAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAGGGAGCCACCCCACA AGATTTAAATATGATGCTGAATGTAGTGGGGGGACACCAGGCAGCTATGCAAATGTTAAAAGATACCATC AATGAGGAAGCTGCAGAGTGGGACAGGTTACATCCAGTGCATGCAGGGCCTATTCCACCAGGCCAGATGA GAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGCACCGTTCAAGAACAAATAGGATGGATGACA-- -GGCAATCCACCTATCCCAGTGGGAGACATCTATAGAAGATGGATAATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTTAGCATTTTGGACATAAGACAAGGGCCAAAAGAACCCTTCAGGGATTATGTAG ATAGATTCTTTAAAACTCTCAGAGCTGAGCAAGCTACACAGGATGTAAAAAACTGGATGACAGAAACCTT GCTGGTCCAAAATGCGAATCCAGACTGTAAGTCCATTTTAAGAGCATTAGGGCCAGGGGCTACATTAGAA GAAATGATGACAGCATGCCAGGGAGTGGGAGGACCCGGCCATAAAGCAAGGGTTTTGGCTGAGGCAATGA GTCAAGTA---CAACAG------------------ACAAGCATAATGATGCAGAGAGGCAATTTTAGGGG CCCGAGAAGA------ATTAAGTGTTTCAACTGTGGCAAAGAAGGACACCTAGCCAAAAATTGTAGGGCC CCTAGGAAAAAGGGCTGTTGGAAATGCGGGAAAGAAGGACACCAAATGAAAGACTGCACT---GAG---A GACAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCAGGGAATTTTCCTCAGAGCAG ACCA------GAGCCAACAGCCCCACCAGCAGAA---------------------------------ATC TTTGGGATGGGGGAAAAGATG---ACCTCCCCTGCGAAACAGGAGCTG---AAAGACAGGGAACAG---- --ACTCCTTTAGTTTCCCTCAAATCACTCTTTGGCAACGACCCCTTGTCACAGTAA ; D-NDK ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATACATGGGAAAGAATTCGGTTACGGCCAG GAGGAAAGAAAAAATATGCACTAAAACATTTGATATGGGCAAGCAGGGAGCTAGAACGATTTACACTTAA TCCTGGCCTTTTAGAGACATCAGAAGGCTGTAAACAAATAATAGGACAGCTACAACCATCTATTCAAACA GGATCAGAAGAAATTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTACATGAAAGGATAGAGG TAAAAGACACCAAAGAAGCTGTAGAAAAGATGGAGGAAGAACAAAACAAAAGTAAG---AAAAAGACA-- ----CAGCAA---GCAGCAGCT---GATAGC---------AGCCAGGTCAGCCAAAATTACCCTATAGTG CAGAACCTACAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTGAACGCATGGGTAAAAGTAA TAGAAGAAAAGGCCTTCAGCCCGGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCTATGCAAATGCTAAAAGAGACCATC AATGACGAAGCTGCAGAATGGGACAGATTACATCCAGTGCATGCAGGGCCTGTTGCACCAGGCCAAATGA GAGAACCAAGGGGAAGTGATATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGCATGGATGACA-- -AGCAACCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAGGGACCAAAGGAACCTTTTAGAGACTATGTAG ACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGATGTAAAAAACTGGATGACAGAAACCTT GTTGGTCCAAAATGCAAACCCAGATTGTAAAACTATCTTAAAAGCATTGGGACCACAGGCTACACTAGAA GAAATGATGACAGCATGCCAGGGAGTGGGGGGGCCCGGCCATAAAGCAAGAGTTTTGGCTGAGGCAATGA GCCAAGTA---ACAGGTTCA------------GCTACTGCAGTAATGATGCAGAGAGGCAATTTTAAGGG CCCAAGAAAA---AGTATTAAGTGTTTCAACTGTGGCAAGGAAGGGCACACAGCAAAAAATTGCAGGGCC CCTAGAAAAAAGGGCTGTTGGAAATGCGGAAGGGAAGGACACCAAATGAAAGATTGCACT---GAA---A GACAGGCTAATTTTTTAGGGAAGATTTGGCCTTCCCACAAGGGAAGGCCGGGGAATTTTCTTCAGAGCAG ACCA------GAGCCAACAGCCCCACCAGCAGAG---------------------------------AGC TTCGGGTTTGGGGAGGAGATA---ACCCCCTCTCAGAAACAGGAGCAG---AAAGACAAGGAACTG---T AT---CCTTTAGCTTCCCTCAAATCACTCTTTGGCAACGACCCCTCGTCACAATAA ; D-Z2Z6 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTGGATGCATGGGAAAAAATTCGGTTACGGCCAG GAGGAAAGAAAAAATATAGACTAAAACATCTAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCACTTAA TCCTGGCCTTTTAGAGACATCAGATGGCTGTAAACAAATAATAGGACAGCTACAACCAGCTATCCGGACA GGATCAGAAGAACTTAGATCATTATTTAATACAGTAGCAACCCTCTATTGTGTACATGAAAGGATAGAGG TAAAAGACACCAAGGAAGCTTTAGAAAAGATGGAGGAAGAACAAAACAAAAGTAAGAACAAAAAGGCA-- ----CAGCAA---GCAGCAGCT---GACGCAGGGAACAACAGCCAGGTCAGCCAAAATTATCCTATAGTG CAGAACCTACAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTGAACGCATGGGTAAAAGTAA TAGAAGAAAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAATACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGCTAAAGGAGACCATC AATGAGGAAGCTGCAGAATGGGATAGGTTACATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGA GAGAACCAAGGGGAAGTGATATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGCATGGATGACA-- -AGCAACCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAGGGACCAAAGGAACCTTTTAGAGACTATGTAG ACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAAGTAAAAGGTTGGATGACAGAAACCTT GTTGGTCCAAAATGCAAACCCAGATTGTAAGACCATCTTAAAAGCATTGGGACCACAGGCTACACTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGGGGGCCCAGCCATAAAGCAAGAGTTCTGGCTGAGGCAATGA GCCAAGCA---ACAAATTCA------------GCTGCCGCAGTAATGATGCAGAGAGGCAATTTTAAGGG CCCAAGAAAA---ACTATTAAGTGTTTCAACTGTGGCAAAGAAGGGCACATAGCAAAAAATTGCAGGGCC CCTAGGAGAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAACTGAAGGATTGCACT---GAA---A GACAGGCTAATTTTTTAGGGAAGATTTGGCCTTCCCACAAGGGAAGGCCGGGGAACTTTCTTCAGAGCAG ACCA------GAGCCAACAGCCCCACCAGCAGAG---------------------------------AGC TTCGGGTTTGGGGAAGAGATA---ACCCCCTCTCAGAAACAGGAGCAG---AAAGACAAGGAACTG---T AT---CCTTCAACTGCCCTCAAATCACTCTTTGGCAACGACCCCTTGTTACAATAA ; D-ELI ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATAAATGGGAAAAAATTCGGTTACGGCCAG GAGGAAAGAAAAAATATAGACTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATATGCACTTAA TCCTGGCCTTTTAGAAACATCAGAAGGCTGTAAACAAATAATAGGGCAGCTACAACCAGCTATTCAGACA GGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTACATAAAGGAATAGATG TAAAAGACACCAAGGAAGCTTTAGAAAAGATGGAGGAAGAGCAAAACAAAAGTAAG---AAAAAGGCA-- ----CAGCAA---GCAGCAGCT---GACACAGGAAACAACAGCCAGGTCAGCCAAAATTATCCTATAGTG CAGAACCTACAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTGAACGCATGGGTAAAAGTAA TAGAAGAAAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGCTAAAAGAGACCATC AATGAAGAAGCTGCAGAATGGGATAGGTTACATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGA GAGAACCAAGGGGAAGTGATATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGCATGGATGACA-- -AGTAACCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATTGTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAGGGACCAAAGGAACCTTTTAGAGACTATGTAG ACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGATGTAAAAAATTGGATGACAGAAACCTT GTTGGTCCAAAATGCAAACCCAGATTGCAAGACTATCTTAAAAGCATTGGGACCACAGGCTACACTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGGGGGCCCAGCCATAAAGCAAGAGTTCTGGCTGAGGCAATGA GCCAAGCA---ACAAATTCA------------GTTACTACAGCAATGATGCAGAGAGGCAATTTTAAGGG CCCAAGAAAA---ATTATTAAGTGTTTCAATTGTGGCAAAGAAGGGCACATAGCAAAAAATTGCAGGGCC CCTAGGAAAAAGGGCTGTTGGAGATGTGGAAAGGAAGGACACCAACTAAAAGATTGCACT---GAG---A GACAGGCTAATTTTTTAGGGAGAATTTGGCCTTCCCACAAGGGAAGGCCGGGGAACTTTCTCCAAAGCAG ACCA------GAGCCAACAGCCCCACCAGCAGAG---------------------------------AGC TTCGGGTTTGGGGAAGAGATA---ACCCCCTCTCAAAAACAGGAGCAG---AAAGACAAGGAACTG---T AT---CCTTTAACTTCCCTCAAATCACTCTTTGGCAACGACCCCTTGTCGCAATAA ; B-RF ATGGGTGCGAGAGCGTCAGTATTAAGCGGCGGAAAATTAGACAAATGGGAAAAAATTCGGTTAAGGCCAA GGGGAAAGAAAAGATATAAGTTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCTGTCAA TCCTAGCCTTTTAGAGACAGCAGAGGGCTGTAGACAAATACTGGGACAGCTACAACCAGCCCTTCAGACA GGATCAGAAGAACTTAAATCATTATATAATGCAGTAGCAACCCTCTATTGTGTACATCAAAATATAGAGG TAAGAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAG---AAAAAAGCA-- ----CAGCAA---GCAGCAGCT---GACACAGGAAACGGCAGCCAGGTCAGCCAAAATTACCCTATAGTG CAGAACCTTCAGGGGCAAATGGTACATCAAGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAG TAGAAGAGAAGGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACTATC AATGAGGAAGCTGCAGAATGGGATAGATTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGTCAGATGA GAGAACCAAGGGGAAGTGACATAGCAGGAACCACTAGTACCCTTCAGGAACAAATAGGATGGATGACA-- -AATAATCCACCTATCCCAGTAGGAGAAATCTATAAAAGGTGGATAATTCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCCATCAGCATTCTGGACATAAGACAAGGACCTAAGGAACCCTTTAGAGACTATGTAG ACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGATGTAAAAAATTGGATGACAGAAACCTT CCTGGTCCAAAATGCGAACCCAGATTGTAAAACTATTTTAAAAGCATTGGGACCAGCAGCTACACTAGAA GAAATGATGACAGCATGTCAGGGAGTAGGGGGACCCAGCCATAAAGCAAGAATTTTGGCTGAAGCAATGA GCCAAGTA---ACAAATTCA---------------GCTACCATAATGCTGCAGAAAGGTAATTTTAGGGA CCAAAGAAAA---ATTGTTAAGTGTTTCAACTGTGGCAAAGTAGGGCACATAGCCAAAAATTGCAGGGCC CCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGCACTAATGAGGGAC GACAGGCTAATTTTTTAGGGAAAATCTGGCCTTCCCACAAGGGAAGGCCAGGGAACTTTCTTCAGAGCAG ACCA------GAGCCAACAGCCCCACCAGAAGAG---------------------------------AGC TTCAGGTTTGGGGAAGAGACA---ACTCCCTCTCAGAAGCAGGAGAAG---ATAGACAAGGAACTG---T AT---CCTTTAGCTTCCCTCAAATCACTCTTTGGCAACGACCCATCGTCACAGTAA ; B-HXB2 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAG GGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAA TCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACA GGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGA TAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAG---AAAAAAGCA-- ----CAGCAA---GCAGCAGCT---GACACAGGACACAGCAATCAGGTCAGCCAAAATTACCCTATAGTG CAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAG TAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATC AATGAGGAAGCTGCAGAATGGGATAGAGTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGA GAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACA-- -AATAATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAG ACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCGGCTACACTAGAA GAAATGATGACAGCATGTCAGGGAGTAGGAGGACCCGGCCATAAGGCAAGAGTTTTGGCTGAAGCAATGA GCCAAGTA---ACAAATTCA---------------GCTACCATAATGATGCAGAGAGGCAATTTTAGGAA CCAAAGAAAG---ATTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACACAGCCAGAAATTGCAGGGCC CCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACT---GAG---A GACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAG ACCA------GAGCCAACAGCCCCACCAGAAGAG---------------------------------AGC TTCAGGTCTGGGGTAGAGACAACAACTCCCCCTCAGAAGCAGGAGCCG---ATAGACAAGGAACTG---T AT---CCTTTAACTTCCCTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAA ; B-OYI ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATAAATGGGAAAAAATTCGGTTAAGGCCAG GGGGAAAGAAAAAATATCAACTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAATTAA TCCTGGCCTGTTAGAAACATCAGAAGGTTGTAGACAAATACTGGGACAGCTACAACCATCCCTTAAGACA GGATCAGAAGAAATTAGATCATTATATAATACAGTAGCAACTCTTTATTGTGTGCATCAAAAGATAGAGG TAAAAGACACCAAGGAAGCTTTAGATAAGATAGAGGAAGAGCAAAACAAAAGTAAG---AAAAAAGCA-- ----CAGCAA---ACAGCAGCT---GACACAGGAAACAGCAGCCAGGTCAGCCAAAATTACCCTATAGTA CAGAACCTTCAGGGGCAAATGGTACATCAGCCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAG TAGAAGAGAAGGCTTTCAGCCCAGAAGTAATACCCATGTTTTCAGCATTAGCAGAAGGAGCCACCCCACA AGATCTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATC AATGAGGAAGCTGCAGAATGGGATAGATTGCATCCAGTACATGCAGGGCCTATTGCACCAGGCCAGATGA GAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACA-- -AATAATCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAG ACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGATGTAAAAAATTGGATGACAGAAACCTT GTTGGTCCAAAATGCAAACCCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCAGCTACACTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGGGGACCCGGCCATAAAGCAAGAGTTTTGGCTGAAGCAATGA GCCAAGTA------AATTCA---------------GTCACCGTAATGATGCAGAAAGGCAATTTTAAGAA CCAAAGAAAG---ACTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACATAGCCAAAAATTGCAGGGCT CCTAGGAAAAAGGGCTGTTGGAAATGTGGAAGGGAAGGACACCAAATGAAAGATTGTACT---GAG---A GACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCCACAAGGGAAGGCCAGGGAATTTTCTTCAGAACAG ACCA------GAGCCAACAGCCCCACCAGCAGAG---------------------------------AGC TTCGGGTTTGGGGAAGAGACAACAACTCCCCCTCAGAAGCAGGAGCCG---ATAGACAAGGGACTG---T AT---CCTTTAACCTCCCTCAGATCACTCTTTGGCAACGACCCATCGTCACAATAA ; C-92BR025 ATGGGTGCGAGAGCGTCAATATTAAGAGGCGGAAAATTAGATGCTTGGGAAAGAATTAAGTTAAAGCCAG GGGGAAAGAAACACTATATGATGAAACACCTAGTCTGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTGA CCCTGGCCTTTTAGAGACATCCGAAGGCTGTAAACAAATAATGAAACAGCTACAACCAGCTCTTCAGACA GGAACAAAGGAACTTATATCATTACATAATACGGTTGCAACTCTCTATTGTGTACATGAAAAGATAGATG TACGAGACACCAAGGAAGCCTTAGACAAAATAAAGGAAGAACAAAACAAAAGTCAG---CAAAAAACA-- ----CAGCAG---GCAGAAGCGGCTGACAAAGGA---------AAGGTCAGTCAAAATTATCCTATAGTA CAGAATCTCCAAGGGCAAATGGTACACCAGCCCATATCAGCTAGAACTTTGAATGCGTGGGTAAAGGTAG TAGAGGAGAAGGCTTTCAGCCCAGAGGTAATACCCATGTTTACAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAACACCATGTTAAATACAGTGGGGGGACACCAAGCAGCCATGCAAATGTTAAAAGATACCATC AATGAGGAGGCTGCAGAATGGGATAGATTACATCCAGTGCATGCAGGGCCTGTCGCACCAGGCCAAATGA GAGAACCAAGGGGAAGTGACATAGCAGGAACTACCAGTACCCTTCAGGAACAAATAACATGGATGACA-- -AATAACCCACCTGTCCCAGTAGGAGACATCTATAAAAGATGGATAATTCTGGGGTTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAAACAAGGGCCAAAGGAACCCTTTAGAGACTATGTAG ACCGGTTCTTTAAAACTCTAAGAGCAGAGCAAGCTACCCAAGATGTAAAAAATTGGATGACAGATACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAGACCATTTTAAGAGCATTAGGGCCAGGGGCTTCATTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCTGGCCACAAAGCAAGAGTGTTGGCTGAGGCAATGA GCAAAGTA---AACAATACA------------AAC------ATAATGATGCAAAGAAGCAATTGTAAAGG CCCTAAAAGA---ACTATTAAATGCTTCAACTGTGGCAAGGAAGGGCACTTAGCCAGAAATTGCAGGGCT CCTAGGAAAAAAGGCTGTTGGAAATGTGGAAAAGAAGGACACCAAGTGAAAGACTGTACT---GAG---A GGCAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCCACAGGGGGAGGCCAGGAAATCTTCTTCAGAACAG AACA------GAGCCAACAGCCCCACCAGAAGAG---------------------------------AGC TTCAGGTTTGGGGAAGAGACAACAACTCCCTCTCGGAAGCAGGAGACG---ATAGACAAGGAACTG---- -----CCCTTAACTTCCCTCAAATCACTCTTTGGCAGCGACCCCTTGTCAACATAA ; C-ETH2220 ATGGGTGCGAGAGCGTCAATATTAAGAGGCGAAAAATTAGATGCCTGGGAAAAAATTAAGTTAAGGCCAG GGGGAAAGAAACACTATATGCTGAAACACCTAGTCTGGGCAAACAGGGAGCTGGAAAAATTTGCACTTAA CCCTGACCTTTTAGATACATCAGCAGGCTGTAAACAAATAATTAAACAGCTACAACCAGCTCTTCAGACA GGAACAGAGGAACTTAAATCATTATTTAATACAGTGGCAACTCTCTATTGTGTACATCAAAAGATAGAGA TAAAAGACACCAAGGAAGCCTTAGACAAGATAGAGGAAGAACAAAACGAAAGTCAG---CAAAAAACA-- ----CAGCAGGCAGGAGCAGCT---GACAGAGGA---------AAGGACAGTCAAAATTATCCTATAGTG CAGAATATGCAGGGGCAAATGGTACATCAGCCCATATCAGCTAGAACTTTGAATGCATGGGTAAAAGTAG TAGAGGAAAAGGCTTTCAGCCCAGAGGTAATACCCATGTTTACAGCTTTATCAGAAGGAGCCACCCCACA AGATTTAAACACCATGCTAAATACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGACACCATC AATGAGGAGGCTGCAGAATGGGACAGGTTACATCCAGTGCATGCAGGGCCTGTTGCACCAGGCCAAATGA GAGACCCAAGGGGAAGTGACATAGCAGGAACAACTAGTACCCTTCAGGAACAAATAGCATGGATGACA-- -GGGAACCCACCTGTTCCAGTGGGAGACATCTATAAAAGATGGATAATCCTGGGGCTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAAACAAGGACCAAAGGAACCTTTTAGAGACTATGTAG ACCGGTTCTTTAAAACCTTAAGAGCTGAACAAGCTACACAAGATGTAAAAAATTGGATGACAGACACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAAACCATTTTAAGAGCATTAGGGCCAGGGGCTTCATTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCTGCCCACAAAGCAAGAGTGTTGGCTGAGGCAATGA GCCAAGTA---AACAATACA------------------ACCATAATGATGCAGAAAAGCAATTTTAAGGG CCCTAAAAGA---GCAATTAAATGTTTCAACTGTGGCAAGGAAGGGCACCTAGCCAGAAATTGCAGGGCC CCTAGGAAAAAAGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGACTGTACC---GAG---A GACAGGCTAATTTTTTAGGGAGACTTTGGCCTTCCAACAAGGGAAGGCCAGGGAATTTCCTTCAGAGCAG ACCA------GAGCCAACAGCCCCACCAGAGAGTCTCAGACCAGAGCCAACAGCCCCACCACCAGAGAGC TTCAGGTTC---GAGGAAGCA---ACACCTTCTCCGAAGCAGGAGCTG---AAAGACAGGGAA------- -----GCCTTAACTTCCCTCAAATCACTCTTTGGCAACGACCACTTGTTACAATAA ; A-92UG037.1 ATGGGTGCGAGAGCGTCAGTATTAAGTGGGGGAAAATTAGATGCATGGGAGAAAATTCGGTTAAGGCCAG GGGGAAAGAAAAAATATAGATTAAAACATCTAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTAA CCCTAGCCTTTTAGAAACAACAGAAGGATGTCAACAAATAATGGAACAATTACAATCAGCTCTCAGAACA GGAACAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGCGTACATCAACGGATAGAGG TAAAAGACACCAAGGAAGCTCTAGATAAAATAGAGGAGATACAAAAGAAAAGCAAG---CAAAAGACA-- ----CAGCAG---GCAGCAGCT---GACACAGGAAGTAGCAGCAAGGTCAGCCAAAATTACCCTATAGTG CAAAATGCACAAGGGCAAATGATCCACCAGTCCTTGTCACCTAGGACTTTGAATGCATGGGTGAAGGTAA TAGAAGAAAAGGCTCTCAGCCCAGAAGTAATACCCATGTTCTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAATATGATGCTGAACATAGTGGGGGGACACCAGGCAGCTATGCAAATGTTAAAAGATACCATC AATGAGGAAGCTGCAGAATGGGACAGGCTACATCCAGTACATGCAGGGCCTGTTGCACCAGGCCAGATGA GAGAACCAAGGGGAAGTGATATAGCAGGAACTACTAGTACCCCTCAAGAACAAATAGCATGGATGACA-- -GGCAACCCACCCATCCCAGTGGGAGACATCTATAAAAGATGGATGATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTTAGCATTTTGGATATAAAACAAGGGCCAAAAGAACCCTTCAGAGACTATGTAG ATAGGTTTTTTAAAACTCTCAGAGCTGAGCAAGCTACACAGGAGGTAAAAGGTTGGATGACAGAAACGTT ACTGATCCAAAATGCAAATCCAGATTGTAAATCCATCCTAAGAGCATTAGGAGCAGGGGCTACATTAGAA GAAATGATGACAGCATGCCAGGGAGTGGGAGGACCCGGCCATAAAGCAAGAGTTTTGGCTGAGGCAATGA GTCAAGTA---CAACATACA------------AAC------ATAATGATGCAGAGAGGCAATTTTAAGGG CCAGAAAAGG------ATTAAGTGTTTCAACTGTGGCAAAGAAGGACATCTAGCCAAAAATTGCAGGGCT CCTAGAAAAAAGGGCTGTTGGAAATGTGGAAGGGAAGGGCACCAAATGAAGGACTGCACT---GAG---A GACAGGCTAATTTTTTAGGGAAAATCTGGCCTTCCAGCAAAGGGAGGCCAGGAAATTTTCCTCAGAGCAG ACCA------GAACCAACAGCCCCACCAGCA------------------------------GCAGAGATC TTTGGGATGAGGGAAGAGATA---GTCTCCCCTCCGAAGCAGGAGCAG---AACGACAGGGACCAGAAC- --CCACCTTCAGTTTCCCTCAAATCACTCTTTGGCAACGACCTCTTGTCACAGTAA ; D-94UG114.1 ATGGGTGCGAGAGCGTCAGTATTAAGCGGAGGAAAATTAGATGAATGGGAAAAAATTCGGTTACGGCCAG GGGGAAAGAAAAAATATAGACTAAAACATCTAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCACTTAA TCCTGGCCTTTTAGAAACATCAGAAGGCTGTAGACAAATAATAAGACAGCTACAACCATCTATTCAGACA GGATCAGAGGAAATTAAATCATTATATAATACAGTGGTAACCCTCTATTGTGTACATGAGAGGATAAAGG TAGCAAGCACCAAGGAAGCTTTAGACAAGATAGAGGAAGAACAAGCCAAAAGTAAG---AAAAAAGCA-- ----CAGCAA---GCAACAGCT---GACACAAGAAACAGCAGCCAGGTCAGCCAAAATTATCCTATAGTG CAAAACCTACAGGGGCAAATGGTACACCATCCCCTATCACCTAGAACTTTGAACGCATGGGTAAAAGTAA TAGAGGAGAAGGCTTTCAACCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAATACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAGGATACCATC AATGAGGAAGCTGCAGAATGGGATAGGCTACATCCAGTGCATGCAGGGCCTGTTGCACCAGGCCAATTGA GAGAACCAAGGGGAAGTGATATAGCAGGAACTACTAGTAACCTTCAGGAACAAATAGGATGGATGACA-- -AGCAATCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTAGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAG ATCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGATGTAAAAAATTGGATGACTGAAACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAAACTATCTTAAAAGCATTGGGACCAGCGGCTACATTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGGGGACCCAGTCATAAAGCAAGAGTTTTGGCTGAGGCAATGA GCCAAGCA---ACAAATGCA------------AATACTGCTATAATGATGCAGAGAGGCAATTTTAAGGG CCCAAAGAAA---ATCATTAAGTGTTTCAACTGTGGCAAAGAAGGGCACACGGCAAAAAATTGCAGGGCT CCTAGAAAAAAGGGCTGTTGGAAATGTGGAAGGGAAGGACACCAAATGAAAGATTGCACT---GAA---A GACAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCCACAATGGAAGGCCAGGGAATTTCCTTCAGAGCAG ACCCCCAGCAGAGCCAACAGCCCCACCAGCAGAG---------------------------------ATC TTCGGATTAGGGGAGGAGATA---ACACCTCCTCAGAAACAGGAGCAG---AAAGACAAGGAACTG---T AT---CCTTTAACCTCCCTCAAATCACTCTTTGGCAACGACCCGTTGTCACAGTAA ; G-92NG003.1(g3) ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCATGGGAAAAAATTCGGTTGAGGCCAG GGGGAAAGAAAAAATATAGAATGAAACATTTAGTATGGGCAAGCAGGGAACTGGAGAGATTTGCACTTAA CCCTGACCTCTTAGAAACAACAGAAGGTTGTCAGCAAATAATGAGACAGCTGCAACCATCTCTCCAGACA GGAACAGAGGAGATTAAATCATTATTTAATACAGTAGCAACCCTCTATTGTGTACATCAAAGGATAGAGG TAAAAGACACCAAAGAAGCTCTAGAGGAAGTGGAAAAAATACAAAAGAACAGTCAG---CAAGAAACA-- ----CAGAAG---GCAGCAATG---GGTAAAGGAAACAGCAGCCAAGTTAGCCAAAATTATCCTATAGTG CAGAATGCACAAGGGCAAGTGGTACACCAGCCCATATCACCTAGGACTTTAAATGCATGGGTAAAAGTAA TAGAAGAAAAGAACTTCAGTCCAGAAGTAATACCCATGTTTACAGCATTATCAGAAGGAGCCACCCCACA AGATTTGAATACCATGCTAAACACCGTGGGGGGGCATCAAGCAGCTATGCAAATGCTAAAAGATTCTATT AATGAAGAAGCTGCAGAGTGGGATAGGCTACATCCACAACAGGCAGGACCTATTCCACCAGGCCAGATAA GAGAACCAAGGGGAAGTGATATAGCAGGAACTACTAGTACCCTGCAGGAACAAATAACATGGATGACC-- -AGCAACCCACCTATCCCAGTGGGAGAAATTTATAAAAGATGGATAATTCTGGGGTTAAATAAAATAGTG AGAATGTATAGCCCTGTCAGTATTTTAGACATAAAACAAGGGCCAAAAGAACCCTTCAGAGATTATGTGG ATAGGTTCTTTAAAACTTTGAGAGCTGAGCAAGCCACACAGGAGGTAAAAAACTGGATGACAGACACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAGACCATCCTAAGAGCATTAGGAGCAGGAGCTACACTAGAA GAAATGTTGACAGCATGTCAAGGAGTGGGAGGACCCAGCCACAAAGCAAGAGTTTTAGCTGAGGCAATGA GCCGGGCA---ACAGGTACA------------TCAGCAGCCATAATGATGCAGAAAAACAATTTTAAGGG CCCGAGAAGA---GGTATTAAGTGTTTCAACTGTGGCAAGGAAGGACATCTAGCCAGAAATTGCAGGGCC CCTAGGAAAAAAGGCTGTTGGAAATGTGGAAAGGAGGGACATCAAATGAAAGACTGCACA---GAG---A GACAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCAGGGAATTTTCTTCAGAACAG GCCA------GAGCCAACAGCCCCACCCGCAGAG---------------------------------AGC TTCGGGTTCGGAGAGGAGATA---GCCCCTTCCCTGAAGCAGGAGCCG---AGGGAAAAGGAATCA---- --CCTCCATTAACCTCCCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAGTAA ; G-92NG083.2(jv10832) GTGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATTCTTGGGAAAAAATTCGGTTAAGGCCAG GGGGAAGGAAAAAGTATAAACTAAAACATATAGTATGGGCAAGCAGGGAACTGGGGAGATTTGCACTTAA CCGTGACCTTTTAGAAACAGCAGAAGGTTGTGTGCAAATAATGAAACAGTTGCAACCAGCTCTCTAGACA GGAACAGAGGAGCTTAGATCATTATTTAATACAGTAGCAACCCTCTACTGTGTACATCAAAAGATAGAGG TAAAAGACACCAAAGAAGCTCCAGAGGAAGTGGAAAAAATACAAAAGAACAGTCAG---CAAGAAATA-- ----CAGCAG---GCAGCAAAG---AATGAAGGAAACAGTAACCCAGTCAGCCAAAATTATCCTATAGTG CAGAATGCACAAGGGCAAATGATACATCAGGCCATATCACCTAGGACTTTGAATGCGTGGGTAAAAGTAG TAGAAGAAAAGGCCTTCAGTCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAGGGAGCCACCCCACA AGATTTAAATACCATGCTAAATACAGTGGGGGGGCATCAAGCAGCTATGCAAATGCTAAAGGATACTATC AATGATGAAGCTGCAGAGTGGGACAGGATACATCCACAGCAGGCAGGGCCTATTCCACCAGGCCAAATAA GAGAGCCTAGTGGAAGTGATATAGCAGGAACTACTAGTACCCTGCAGGAACAAATAAGATGGATGACC-- -AGCAACCCACCTATCCCAGTGGGAGAAATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTG AGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGATTATGTAG ATAGGTTCTTTAAAACTTTGAGAGCTGAGCAAGCTACACAGGAAGTAAAAGGTTGGATGACAGACACCTT GTTGGTTCAAAATGCGAACCCAGATTGTAAAACCATCTTAAGAGCATTAGGACCAGGAGCTACACTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCCAGCCATAAAGCAAGAGTTTTAGCTGAGGCAATGA GCCAGGCA---TCAGGTGCA---------GCAGCAGCAGCCATAATGATGCAGAAAAGCAATTTTAAGGG CCCGAGAAGA---ATTATTAAGTGTTTCAACTGTGGCAAGGAAGGACATCTAGCCAGAAATTGCAGGGCC CCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAGGGACATCAAATGAAAGAATGCACG---GAA---A GGCAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCAGGAAACTTTCTCCAGAACAG GACA------GAGCCAACAGCCCCACCAGCAGAG---------------------------------AGC TTCGGATTCGGAGAGGAGATA---GCCCCCTCCCCGAAGCAGGAGCCA---AAGGAGAAGGAGCTA---T AT---CCCTTAACTTCCCTCAAATCACTCTTTGGCAGCGACCCCTAGTCACAGTAA ; F-93BR020.1 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCTTGGGAAAAAATTCGGTTAAGGCCGG GGGGAAAGAAAAAATATAGACTAAAACATCTAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCACTTGA TCCAGGCCTTCTAGAAACATCAGAAGGCTGTCGAAAAATAATAGGACAGTTACAACCATCCCTTCAGACA GGATCAGAAGAGCTCAAATCATTATATAATACAATAGCAGTCCTCTATTATGTACATCAAAAGGTAGAGG TAAAAGACACCAAGGAGGCTTTAGAGAAGCTAGAGGAAGAACAAAACAAAGGTCGG---CAAAAGACA-- ----CAGCAA---GCGACTGCT---GAAAAAGGG------------GTCAGTCAAAATTACCCTATAGTA CAGAATCTTCAGGGACAAATGGTACACCAGTCTTTATCACCTAGAACTTTAAATGCATGGGTAAAGGTGA TAGAAGAGAAGGCTTTTAGTCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGGGCCACTCCACA AGATTTAAACACCATGTTAAATACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGACACCATC AATGAGGAGGCTGCAGAATGGGACAGATTACATCCAACACAGGCAGGACCCATCCCCCCAGGTCAGATAA GGGAACCTAGGGGAAGTGATATAGCTGGAACTACTAGTACCCTTCAGGAACAAATACAATGGATGACA-- -GGCAACCCACCTGTCCCAGTGGGAGAAATGTATAAAAGATGGATCATCCTAGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTCGGCATTTTGGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGACTATGTAG ACAGGTTCTTTAAAACCCTAAGAGCTGAGCAAGCTACACAGGAAGTAAAGGGTTGGATGACAGACACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAGACCATTTTAAAAGCATTGGGACCAGGGGCTACACTAGAG GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCTAGCCATAAGGCAAGAGTTTTGGCTGAGGCAATGA GCCAAGCA---ACAAATACA------------------GCTATAATGATGCAGAAAAGTAACTTTAAGGG CCAAAGAAGA---ATTGTTAAATGCTTTAATTGTGGCAAAGAAGGACACATAGCCAAAAATTGCAGGGCC CCTAGAAAAAAGGGCTGTTGGAAGTGTGGAAGAGAGGGACACCAAATGAAGGACTGCACT---GAG---A GACAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCCGGAAACTTCATCCAGAACAG GCCA------GAGCCGTCAGCCCCGCCAGCAGAG---------------------------------AGC TTCAGGTTCGGGGAGGAGACA---ACCCCATCTCCGAAGCAGGAGCAG---AAAGACGAGGGACTG---T ACCCTCCCTTAGCTTCCCTCAAATCACTCTTTGGCAACGACCCCTAGTCACAATAA ; H-90CR056.1(u40561) ATGGGTGCGAGAGCGTCAGTATTAAGCGGCGGAAAATTAGATGCTTGGGAGAAAATTCGGCTAAGGCCAG GGGGAAAGAAAAAATATAGGCTAAAACATCTAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTAA CCCCGGCCTTTTAGAAACACCAGAAGGCTGTCTACAGATAATAGAACAGATACAGCCAGCTATTAAGACA GGAACAGAAGAACTTAAATCATTATTTAATCTAGTAGCAGTCCTCTATTGCGTACATCGAAAAATAGATG TGAAAGACACCAAGGAGGCTTTAGATAAGATAGAGGAAATACAAAACAAAAGTCAG---CAAAAAACA-- ----CAGCAA---GCAGCAGCT---GATAAGGAAAAAGACAACAAGGTCAGTCAAAATTATCCTATAGTA CAGAATGCTCAAGGGCAGATGGTACACCAGGCCATATCACCTAGGACCTTAAATGCATGGGTAAAAGTAG TAGAAGAAAAGGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACA AGACTTAAATGCTATGCTAAATACAGTGGGGGGACATCAAGCAGCCATGCAGATGTTAAAAGATACAATC AATGAGGAAGCTGCAGAATGGGACAGGGTACATCCAGTGCATGCAGGGCCTATTCCACCAGGCCAAATGA GAGAACCAAGGGGAAGCGATATAGCAGGAACTACTAGTACCCTGCAGGAACAAATAGCATGGATGACA-- -GGCAATCCAGCTATCCCAGTGGGAGACATCTATAAAAGATGGATAATCCTGGGATTAAATAAGATAGTA AGAATGTATAGTCCTGTCAGCATTCTGGACATAAAACAAGGGCCAAAAGAACCCTTTAGAGACTATGTAG ACAGGTTTTTTAAAACTTTAAGAGCTGAGCAAGCCACACAGGATGTGAAGAATTGGATGACAGAAACCTT GTTGGTCCAAAATGCAAATCCAGATTGCAAGACTATATTAAGAGCATTAGGACAAGGGGCTTCAATAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCTAGTCATAAAGCAAGAGTTTTGGCTGAGGCAATGA GCCAAGTA---ACAAATACA------------AATACAGCCATAATGATGCAGAAAGGCAACTTTAAGGG CCAAAGAAAA---TTTGTTAAATGCTTCAACTGTGGCAAAGAGGGACACATAGCCAGAAATTGCAGGGCC CCTAGGAAAAAGGGCTGTTGGAAATGTGGAAGAGAAGGACATCAGATGAAAGACTGCACA---GAG---A GACAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCAGCAAAGGGAGGCCAGGAAATTTTCTCCAGAGCAG GCCA------GAACCAACAGCCCCACCAGCAGAG---------------------------------AGC TTCGGGTTCGGAGAGGAGATG---ACCCCCTCTCCGAAGCAGGAGCAGCTGAAGGACAAGGAA------- --CCTCCCTTAGCTTCCCTCAGATCACTCTTTGGCAGCGACCCCTTGTTACAGTAA ; A-VI32 ATGGGTGCGAGAGCGTCAGTATTAAGTGGGGGAAAATTAGATGCATGGGAGAAAATTAGGTTAAGGCCAG GGGGAAAGAAAAAATATAGAATGAAACATTTAGTATGGGCAAGCAGGGAGCTGGACAGATTCGCACTTAA CCCTAGCCTTCTGGAAACAAAAGAAGGATGTCAACAGATAATGGAACAGTTAGAATCAGCTCTCAAGACA GGAACAGAAGAAATTAAATCATTATATAATACAGTAGCAGTCCTCTTTTGTGTACATCAACGGATAGATG TAAAAGACACCAAGGAAGCCTTAGATAAAATAGAGGAAATAAAAAATAAGAGTAAG---CAAAAGGCA-- ----CAACAG---GCAGCAGCT---GACACAGGAAACAGCGGCAAAGTCAGCCAAAATTACCCTATAGTG CAAAATGCACAAGGGCAAATGATACATCAGTCCTTATCACCTAGGACTTTGAATGCATGGGTGAAAGTAA TAGAAGAAAAGGCTTTTAGCCCAGAAGTAATACCCACGTTCTCAGCATTGTCAGAAGGAGCCACCCCACA AGATTTAAATATGATGCTAAATATAGTGGGGGGACACCAGGCAGCTATGCAAATGTTAAAAGATGCCATC AATGAGGAAGCTGCAGGATGGGACAGGTTACATCCAGTACATGCAGGGCCTATTCCACCAGGCCAAATGA GAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCCTCAAGAACAAATAGGATGGATGACA-- -AGCAACCCACCTATCCCGGTGGGAGACATTTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTTAGCATTTTGGACATAAAACAAGGGCCAAAAGAACCCTTCAGAGACTATGTAG ATAGATTCTTTAAAACTCTCAGAGCTGAACAAGCTACACAGGAGGTAAAAGGTTGGATGACAGAAACTTT GCTGGTCCAAAATGCAAATCCAGATTGTAAGTCCATTTTAAGAGCATTAGGACCAGGGGCTACATTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCCGGCCATAAAGCAAGGGTTTTGGCTGAGGCAATGA GTCACGTA---CAACAGGCA------------AAC------ATAATGATGCAAAGAGGCAATATCAGGGG CGGCTAGAAA---AGAATTAAGTGTTTCAACTGTGGCAAAGAAGGACACCTAGCCAGAAATTGCAGGGCC CCTAGGAAAAAGGGCTGTTGGAAATGTGGGAAGGAGGGACACCAAATGAAAGACTGCACCAATGAG---A GACAGGCTAATTTTTTAGGGAAAATCTGGCCTTCCAACAAGGGGAGGCCAGGAAATTTTCCTCAGAGCAG ACCG------GAGCCATCAGCCCCACCAGCAGAG---------------------------------ATC TTTGGGATGGGGGAAGAGATA---GCCTCCCCTCCGAAGCAGGAGCAG---AAAGACAGGGAACAG---A GCCAACCTTTAGTTTCCCTCAAATCA------------------------------ ; B-JRFL ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTGGATAAATGGGAAAAAATTCGGTTAAGGCCAG GGGGAAAGAAAAAATATAGATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGTTTCGCAGTTAA TCCTGGCCTGTTAGAATCATCAGAAGGCTGTAGACAAATACTGGGACAACTACTACCAGCCCTTAAGACA GGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTACATCAAAGGATAGAGG TAAAAGACACCAAGGAAGCTTTAGAAAAGATAGAGGAAGAGCAAGCCAAAAGTAAG---AAAAAA----- -------GAA---GCAGCAGCT---GACACAGGAAACAGCAGCCAGGTCAGCCAAAATTACCCTATAGTG CAGAACATGCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAG TAGAAGAGAAGGCTTTCAGCCCCGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGCTAAAAGAGACCATC AATGAGGAAGCTGCAGAATGGGATAGATTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAAATGA GAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACA-- -AATAATCCACCTATCCCAGTAGGAGAAATCTATAAAAGATGGATAATCCTGGGGTTAAATAAAATAGTA AGGATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAG ACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCAGCCACACTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCCGGCCATAAAGCAAGAGTTTTGGCTGAAGCAATGA GCCAAGTA---ACAAATCCA---------------GCTACCATAATGATGCAGAGAGGCAACTTTAGGAA CCAAAGAAAG---ATTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACATAGCCAGAAATTGCAGGGCC CCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACT---GAG---A GACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAG ACCA------GAGCCAACAGCCCCACCAGAAAAG---------------------------------AGC TTCAGGTTTGGGGAAGAGACAGCAACTCCCTCTCAGAAGCAGGAGCCG---ATAGACAAGGAAATG---T AT---CCTTTAACTTCCCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAA--- ; C-ZAM18 ATGGGTGCGAGAGCGTCAATATTAAAAGGGGGAAAATTAGATACATGGGAAAAAATTAGGTTAAGGCCAG GGGGAAAGAAACACTATATGATAAAACACCTAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTTAA CCCTGGCCTTTTAGAGACATCAGAAGGCTGTAAACAAATAATAAAACAGCTACAACCATCTATTCAGACA GGAACAGAGGAACTTAAATCATTATTCAACACAGTAGTAACTCTATGGTGTGTACATGAAGATATAACAG TACGAGACACCAAGGAAGCCTTAGACAGGTTAGAGGAAGAACAAAACAAAAGTCAG---CAAAAAACAAA AACACAGCAG---GCAAAAGCGGCTGAC---GGACAG---------GTCAGTCAAAATTACCCTATAGTG CAGAATCTCCAAGGGCAAATGATACACCAGGCCATATCACCTAGAACTTTGAATGCATGGGTAAAAGTAA TAGAGGGAAAAGCCTTTAGCCCAGAGATAATACCCATGTTTACAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAACACCATGTTAAATACAGTGGGGGGACATCAAGCAGCCATGCAGATGTTAAAAGATACCATC AATGAGGAGGCTGCAGAATGGGATAGATTACATCCAGTACATGCAGGGCCTAATGCACCAGGCCAATTGA GAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAGATAGCATGGATGACA-- -AATAACCCACCTGTTCCAGTGGGAGACATCTATAAAAGATGGATAATTCTGGGGTTAAATAAAATAGTC AGAATGTATAGCCCTGTCAGCATTTTGGACATAAAACAAGGGCCAAAGGAACCTTTTAGAGACTATGTAG ACCGGTTCTTTAAAACTTTAAGAGCTGAACAAGCTACACAAGATGTAAAAAATTGGATGACAGAAACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAGACCATTTTAAGAGCATTAGGACCAGCGGCTACATTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCTAGCCACAAAGCAAGAGTGTTAGCTGAGGCAATGA GCCAAGCA---AACAATACA------------AAC------ATACTGATGCAGAGAAGCAATTTTAAAGG ACCTAAAAGA---AGTGTTAAATGTTTCAACTGTGGCAAGGAAGGGCACATAGCCAAAAATTGCAGGGCC CCTAGGAAAAAAGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGACTGTACC---GAG---A GGCAGGCTAATTTTTTAGGGAAAATCTGGCCTTCCCACAAGGGGAGGCCAGGGAATTTCCTTCAGAGCAG GCCA------GAGCCAACAGCCCCTAGGCCAGAG------------CCAACAGCCCCACCAGCAGAGAGC TTCAGGTTC---GAGGAGACG---ACCCCCGCTCCGAATCAGGAGCCG---AAAGACAGGGAA------- -----CCCTTAACTTCCCTCAAATCA------------------------------ ; F-VI174 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCATGGGAAAAAATTCAGTTAAGGCCGG GGGGGAAGAAAAAATATAGAATGAAGCATCTAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCAATTGA TCCTGGTCTTCTAGAAACACCAGAAGGCTGTAGGAAAATAATAGGACAGCTACAAACATCCCTTCAGACA GGATCAGAAGAGCTTAGATCATTGTTTAATACAATAGTAGTCCTCTATTATGTACATCAAAGGGTAGAGA TAAAGGACACCAAGGAAGCTTTAGAAAAGCTAGAGGAAGAACAAAACAAAAGTCAG---CAAAAGACA-- ----CAGCAG------GCAGCT---GACAAAGGA------------GTCAGTCAGAATTACCCTATAGTA CAAAATCTTCAGGGACAAATGGTACATCAGGCTATATCACCTAGAACTTTAAATGCATGGGTAAAGGTGA TAGAAGAGAAAGCTTTTAGCCCAGAAGTAATACCCATGTTCTCAGCATTATCAGAAGGGGCCACCCCACA AGATTTAAACACCATGCTAAATACAGTGGGGGGACATCAAGCAGCTATGCAAATGTTAAAAGACACCATC AATGAGGAAGCTGCAGAATGGGACAGATTACATCCAGTGCAGGCAGGGCCTATCCCACCAGGCCAGATAA GGGAACCTAGGGGAAGTGACATAGCTGGAACTACTAGTACCCTTCAGGAACAAATACAATGGATGACA-- -AACAACCCACCTGTCCCAGTGGGAGAAATCTATAAAAGATGGATCATCCTAGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGACTATGTAG ACAGGTTCTTTAAAACTCTAAGAGCTGAGCAAGCTACACAGGAAGTAAAGGGTTGGATGACAGACACTTT GTTGGTCCAAAATGCGAACCCAGATTGTAAGACCATCTTAAAAGCATTGGGACCAGGGGCTACACTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCTGGCCATAAGGCAAGAGTTTTGGCTGAGGCAATGA GCCAAGCA---ACAAATACA------------GCAGCAGCCATAATGATGCAGAAAAGTAACTTTAAGGG CCAAAGAAGA---ATTGTTAAATGTTTTAATTGTGGCAAAGAAGGACACATAGCCAGAAATTGCAGGGCC CCTAGAAAAAAGGGCTGTTGGAAATGTGGAAGAGAAGGACACCAAATGAAAGACTGCACT---GAA---A GACAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCCGGAAATTTTCTTCAGAGCAG ACCA------GAGCCAACAGCCCCACCAGCAGAG---------------------------------AGC TTCGGGTTCGGAGAGGAGATA---ACCCCCTCTCCGAAGCAGGAGCAG---AAGGGCGAGGGACTG---T ATCCTCCCTTAGCCTCCCTCAAATCA------------------------------ ; F-VI69 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCATGGGAAAAAATTCGATTAAGACCGG GGGGAAGGAAAAAATACAAAATGAAGCATCTAATATGGGCAAGCAGGGAATTAGAAAGATTTGCACTTGA TCCTGGCCTTCTAGAAACATCAGAAGGCTGTAGAAAAATAATAGGACAGTTACAACCATCCCTTCAGACA GGATCAGAAGAGCTTAGATCATTATATAATACAGTAGCAGTTCTCTATTTTGTACATCAAAAGGTAGAGG TAAAGGACACCAAGGAAGCTTTAGAGAAGCTAGAGGAGGAACAAAACAAAAGTCAG---CAAAAGAAA-- ----CAGCAA---GTGGCAGCT---GACAAAGGG------------GTCAGTCAAAATTACCCTATAGTA CAAAATCTTCAGGGACAAATGGTACACCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAGGTGA TAGAAGAGAAGGCTTTTAGTCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACTCCACA AGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAGGCAGCCATGCAAATGTTAAAAGACACCATC AATGAGGAAGCTGCAGAATGGGATAGATTACATCCAGTGCATGCAGGGCCTAACCCACCAGGCCAGATGA GGGAACCTAGGGGAAGTGATATAGCTGGAACTACTAGTACCCTTCAGGAACAAATACAGTGGATGACA-- -AGCAATCCACCTATCCCAGTGGGAGACATCTATAAAAGATGGATCATCCTAGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGACTATGTAG ACAGATTCTTTAAAACCCTAAGAGCTGAGGAAGCTACACAGGAAGTAAAGGGTTGGATGACAGACACCTT GTTGATCCAGAATGCGAACCCGGATTGTAAAACCATCTTAAAAGCAATGGGACCAGGGGCTACACTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCTGGCCATAAGGCAAGAGTTTTGGCTGAGACAATGA GCCAAGCA---ACAAAT------------------GCAGCCATAATGATGCAGAAAAGTAATTTTAAGGG CCAAAGAAGA---ACTGTTAAATGTTTTAATTGTGGCAAAGAAGGACACGTAGCCAAAAATTGCAGGGCC CCTAGAAAAAAGGGCTGTTGGAAATGTGGAAGAGAGGGACACCAAATGAAAGACTGCACT---GAG---A GACAGGCCAATTTTTTAGGGAAAATTTGGCCTTCCAACAAGGGGAGGCCAGGGAATTTTCTTCAGAGCAG ACCA------GAGCCATCAGCCCCGCCAGCAGAG---------------------------------AGC TTTGGGTTCAGAGAGGAGATA---ACCCCCTCTCCGAAGCAGGAGCAG---AAGGACGAGGGACTG---T CTCCTCCCTTAGCTTCCCTCAAATCA------------------------------ ; F-BZ162 ATGGGTGCGAGAGCGTCAGTATTAAGCGGAGGAAAACTAGATGCATGGGAAAAAATTCGGTTAAGGCCAG GGGGAAAGAAAAAATATAGATTGAAGCATCTAGTATGGGCAAGCAGGGAGCTAGAACGATTTGCAATTAA TCCTGGCCTTCTAGAAACATCAGAAGGCTGTCAA-AAATAATAGGACAGTTACAACCATCCCTTCAGACA GGATCAGAAGAGCTTAGATCATTATATAATACAGTAGCAGTCCTCTATTTTGTACATCAAAGGGTAGAGG TAAAGGACACCAAGGAAGCTTTAGACAAGCTAGAGGAAGAACAAAACAAAAGTCAG---CAAAAGACA-- ----AAGCAA---GCGGCAGCT---GACAAAGGG------------GTCAGTCAAAATTACCCTATAGTA CAGAATCTTCAGGGACAAATGGTACATCAGTCTATATCACCTAGAACTTTAAATGCATGGGTAAAGGTGA TAGAAGAGAAGGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGGGCCACTCCACA AGATTTAAACACCATGTTAAATACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGACACCATC AATGAGGAAGCTGCAGAATGGGACAGATTACATCCAGCGCAGGCAGGACCTATCCCACCAGGCCAGATAA GGGAACCTAGGGGAAGTGATATAGCTGGAACTACTAGTACCCTTCAGGAACAAATACAATGGATGACA-- -AGCAACCCACCTGTCCCAGTGGGAGAAATCTATAAAAGATGGATCATCCTAGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAAGGGCCAAAAGAGCCCTTTAGAGACTATGTAG ACAGGTTCTTTAAAACCCTAAGAGCTGAGCAAGCTACACAGGAAGTAAAGGGTTGGATGACAGACACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAGACCATTTTAAAAGCATTGGGACCAGGGGCTACACTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCTGGCCATAAGGCGAGAGTTTTGGCTGAGGCAATGA GCCAAGCA---ACAAAT------------------GCAACTATACTGATGCAGAAAAGTAACTTTAAGGG CCAAAGAAGA---ATTGTTAAATGTTTTAATTGTGGCAAAACAGGACACATAGCCAAAAATTGTAGGGCC CCTAGAAAAAAGGGCTGTTGGAAATGTGGAAGAGAAGGACACCAAATGAAAGACTGCACT---GAA---G GACAGGCTAATTTTTTAGGGAAAATTTGGCCTTCCCACAAGGGGAGGCCCGGAAATTTCCTCCAGAACAG GCCA------GAGCCAACAGCCCCACCAGCAGAG---------------------------------AGC TTCGGGTTCAGAGAGGAGATA---AACCCCTCTCCGAAGCAGGAGCAG---AAAGAAGAGGGACTG---T ACCCTCCCTTAGCTTCCCTCAAATCA------------------------------ ; H-VI557 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATGCATGGGAGAAAATTCGGTTGAGGCCAG GGGGAAAGAAAAAATATAGACTGAAACATTTAGTATGGGCAAGCAGGGAGCTGGAAAGATTTGCACTCAA CCCCGACCTTTTAGACACAGCAGAAGGCTGTCTACAATTAATAGAACAGCTACAACCAGCTCTTAAGACA GGAACAGAAGAACTTCAATCATTATTTAATCTATTAGCAACCCTCTATTGCGTACATCAAAGAATAGATG TAAAAGACACCAAGGAAGCTTTAGAGAAGTTAAAGGAGGCACAAAACAAAAGCCAG---AACAGGACA-- ----CAGCAG---GCAACAGGT---GATAAAGGAAATGGCAACAAGATCAGTCAAAATTATCCTATAGTA CAAAATGCCCAAGGACAGCCGGTACACCAGGCCATATCACCTAGGACCTTAAATGCATGGGTAAAAGTAG TAGAAGAGAAGGCTTTTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAATGCCATGTTAAATATAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGATACAATC AATGAGGAAGCTGCAGAATGGGATAGGGTACATCCAGTGCATGCAGGGCCTATTCCACCAGGCCAGATGA GAGAACCAAGGGGAAGTGATATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGCATGGATGACA-- -AGCAATCCCCCTATCCCAGTGGGAGACATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGACTATGTAG ATAGGTTCTTTAAAGCTTTAAGAGCTGAACAAGCTACACAGGAGGTGAAAGGTTGGATGACAGACACCTT GTTGGTCCAAAATGCGAATCCAGATTGTAAGACTATTTTAAGAGCATTAGGACAAGGGGCTTCAATAGAA GAAATGATGACAGCCTGCCAGGGAGTGGGAGGGCCTGGCCATAAAGCAAAAGTTTTGGCTGAGGCAATGA GCCAAGTAAATACAAAT------------------GCAGTTATGATGATGCAGAAAGGTAACTTCAAGGG CCAAAGAAGA---ATTATTAAATGTTTCAATTGTGGCAAAGAAGGACACCTAGCCAGAAATTGCAGGGCC CCTAGGAAAAAGGGATGTTGGAAATGCGGAAAGGAAGGACATCAGCTGAAAGACTGCACA---GAA---A GACAGGCTAATTTTTTAGGGAAAATTTGGTCTCCCAACAAAGGGAGGCCAGGGAATTTTCTCCAGAGCAG GCCA------GAGCCAACAGCCCCACCAGCAGAG---------------------------------AGC TTCGGGTTTGGAGAGGAAATG---ACCCCCCCTCCAAAACAGGAGAGG---AAGGATGCAGAA------T CT---CCTTTAACTTCCCTCAAATCA------------------------------ ; A-K89 ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGATACGTGGGAGAAAATTCGGTTAAGGCCAG GGGGAAAGAAAAAATATAAACTGAAACATTTAGTATGGGCAAGCAGGGAGCTGGAAAGATTCGCACTTAA CCCTAGCCTTTTAGAAACAACAGAAGGGTGTCAACAAATAATGGAACAATTACAACCAGCTCTCAAGACA GGGACAGAAGAACTTAGATCATTATTTAATACAGTAGCAACCCTCTGGTGCGTACATCAACAAATAAATG TAAAAGACACCAAGGAAGCTCTGGATAAAATAGAGGAAATACAAAATAAGAACAAG---CAAAAAACA-- ----CAACAG---GCAGCAGCT---GATACAGGAAACAACAGCAAGGTTAGCCAAAATTACCCTATAGTG CAAAATGCACAAGGGCAAATGATACTTCAGACCTTGTCACCTAGGACATTAAATGCATGGGTAAAAGTAA TAGAAGAAAAGGCTTTCAGCCCAGAAGTAATACCCATGTTCTCAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAATATGATGCTGAATATAGTGGGGGGACACCAGGCAGCTATGCAAATGTTAAAAGATACCATC AATGAGGAAGCTGCAGAATGGGACAGGTTACATCCAGTACATGCAGGGCCTATTCCACCAGGCCAAATGA GAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCCTCAAGAACAACTAGGGTGGATGACA-- -AGCAACCCACCTATCCCAGTGGGGGACATCTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTA AGAATGTATAGCCCTGTTAGCATTTTGGATATAAAACAAGGGCCAAAAGAACCCTTCAGAGATTATGTAG ATAGGTTCTTTAAAACTCTCAGAGCTGAGCAAGCTACGCAAGACGTAAAAAATTGGATGACAGAAACATT GCTGGTCCAAAATGCAAATCCAGATTGTAAGTCCATTTTAAGAGCATTAGGAACAGGGGCTACGTTAGAA GAAATGATGACAGCATGCCAGGGAGTGGGCGGACCCGGCCATAAAGCAAGGGTTTTGGCTGAGGCAATGA GTCAGGTA---CAACATACA------------AAC------ATAATGATGCAGAGGGGCAATTTTAGAGG CCAGAAAAGG------ATTAAGTGTTTCAACTGTGGCAAAGAAGGACACCTAGCCAGAAATTGTAGGGCC CCTAGGAAAAAGGGCTGTTGGAAATGTGGGAAGGAGGGACACCAAATGAAAGAATGCACT---GAA---A GACAGGCTAATTTTTTAGGGAGAATTTGGCCTTCCAGCAAGGGGAGGCCAGGAAATTTTCCTCAGAACAG ACTG------GAGCCAACAGCCCCACCAGCAGAG---------------------------------ATC TGTGGGATGGGGGAAGAGATA---GCCTCCCCTTCGAAGCAGGAGCAG---AAAGACCGGGAACAG---- -----GCTTCAATTTCCCTCAAATCA------------------------------ ; C-UG268 ATGGGTGCGAGAGCGTCAGTATTAAGAGGCGGAAAATTAGATACCTGGGAAAAAATTAAGTTAAGGCCAG GGGGAAAGAAATGCTATATGATGAAACACCTAGTCTGGGCAAGCAGGGAGCTGGGAAGATTTGCACTTAA CTCTGGCCTTTTAGAAACATCAGAAGGCTGTAAACAAATAATGAAACAGCTACAACCAGCTCTTCAGACA GGGACAGATGAACTTAGATCATTATATAACACAGTAGCAACTCTCTATTGTGTACATAAAGGGATAGAAG TACGAGACACCAAGGAAGCCTTAGACAAGATAGAGGAAGAACAAAACAAGATTCAG---CAAAAAACA-- -------GAA------ACAGCT---GACAAAGGAAAG---------GTCAGTCAAAATTATCCTATAGTG CAGAATCTCCAAGGGCAAATGGTACACCAGGCCCTATCACCTAGAACTTTGAATGCATGGGTAAAAGTAA TAGAGGAAAAGGCTTTCAGCCCAGAGGTAATACCCATGTTTACAGCATTATCAGAAGGAGCCACCCCACA AGATTTAAACACCATGCTAAATACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGACACCATC AATGAGGAGGCTGCAGAATGGGATAGGTTACATCCAGTGCATGCAGGGCCTGTTGCACCAGGCCAAATGA GAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAAGAACAAATAAATTGGATGACA-- -AGTAACCCACCTATTCCAGTGGGAGAAATCTATAAAAGATGGATAATTCTGGGGTTAAATAAAATAGTA AGAATGTATAGCCCTGTCAGCATTTTGGACATAAAACAAGGGCCAAAGGAACCCTTTAGAGACTATGTAG ATCGGTTCTTTAAAACCTTAAGAGCTGAACAAGCTACACAAGATGTAAAAAATTGGATGACAGACACCTT GTTGGTCCAAAATGCGAACCCAGATTGTAAGACCATTTTAAGAGCATTAGGGCCAGGAGCTTCATTAGAA GAAATGATGACAGCATGTCAGGGAGTGGGAGGACCTGGCCACAAAGCAAGAGTGTTGGCTGAGGCAATGA GCCAAGCAAACAATATA---------------AAC------ATAATGATGCAGAGAAGCAATTTTAAGGG CCCTAAGAGA---ATTATTAAATGTTTCAATTGTGGCAAGGAAGGGCACCTAGCCAGAAATTGCAGGGCC CCTAGGAAAAAAGGCTGTTGGAAATGTGGAAGGGAAGGACACCAAATGAAAGACTGTACT---GAG---A GACAGGCCAATTTTTTAGGGAAGATTTGGCCTCCCAACAAGGGGAGGCCAGGGAATTTCCTTCAGAGCAG ACCA------GAACCAACAGCCCCACCAGCAGAG------------CCAACAGCCCCACCGGCAGAGAGC TTCAGGTTC------GAGGGGACAACTCCCCCTCCGAAGCAGGAGCCG---AAAGACAGGGAACCC---- --------TTAATTTCCCTCAAATCA------------------------------
last modified: Fri Aug 10 14:02 2007


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health