HIV Databases HIV Databases home HIV Databases home
HIV sequence database



; A-U455 ATGAGAGTGATGGGGATACAGAGGAATTATCCTTGCTTGTGGAGATGG-- ----------GGAACTATGATCTTGGGGTTGATAATAATTTGTAATGCA- -----CAACAATTGTGGGTCACGGTCTACTATGGGGTACCTGTGTGGAAA GATGCAGTTACCACCCTATTTTGTGCATCAGATGCTAAAGCATATGATGC AGAAGTGCATAATGTCTGGGCTACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAAATAGATTTGGTCAATGTGACAGAAGAATTTAACATGTGG AAAAATAACATGGTAGATCAGATGCATGAAGATATAATCAGTCTATGGGA CCAAAGCCTAAAGCCATGTGTAAAGTTAACCCCTCTCTGCGTTACGTTAG ATTGCCATAACATC---------ACCATTAACAACACC------------ ---------------AATAACAACACC---------AATATCACAGATGG AGTGAGGGAAGAAATGAAAAATTGCTCTTTCAATATGACCACAGAACTAA GAGATAAGAAACAGAAAGTATATTCACTTTTTTATAGACTTGATATAGTA CAAATCAATAAA---------------------------ACTGATAACAA T------------AGTTATAGACTAATAAATTGTAATACCTCAACCATTA CACAGGCTTGTCCCAAGGTGTCCTTTGAGCCAATTCCCATACATTATTGT GCCCCAGCTGGTTTTGCGATTCTAAAGTGTAAGGATCCTGAGTTCAATGG AAAAGGGCCATGCAGGAATGTCAGCACAGTACAATGTACACATGGAATCA AGCCAGTGGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAAGA GAAATAAGGATTAGATCTGAAAATTTCACAAACAATGCAAAAACCATAAT AGTACAGCTTGTCAATCCTGTAAAAATCAATTGTTCCAGACCTTAC---A ATACAAGAAAAAATATACGTAGGTATAGTATAGGATCAGGACAAGCATTC TATGTA---ACAGGTAAA------ATAATAGGGGATATA---AGACAAGC ACATTGTAATGTCAGTAGAAGGGACTGGAATAGAACTATACAACAGGTAG CTGAACAATTAAAGAAA---------AAGTTTAATAAC---------AAA ACA---------ATAATCTTTGCTAGCTCCTCA---GGAGGGGATATAGA AATTACAACACATAGCTTTAATTGTGGAGGAGAATTTTTCTATTGCAACA CATCAGGCCTGTTTAATAGCATTTGG------AAT--------------- ---GGCAGCATGTCAAATGACATGGGGCCAAATGGCACT---------AT AACTCTCCAATGTAGAATAAAGCAAATTATAAATATGTGGCAGAGAGTAG GACAAGCAATGTATGCCCCTCCCATCCAAGGAGTAATAAGGTGTGAATCA AACATTACAGGACTACTATTAACAAGAGATGGGGGTACTAAC---AAT-- ----ACAAAAAATGAGACCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAAAAGTGAATTATATAAGTATAAAGTAGTAAAAATTGAACCACTA GGAGTAGCACCCACC---------AGGGCAAAGAGAAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTTGGA---CTAGGAGCTATCTTCC TTGGGTTCTTAGGAGCAGCTGGAAGCACAATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAGAG CAATCTGCTGAGGGCTATAGAGGCTCAACAGCATCTGTTGAAACTCACTG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTACAGGATCAACAGCTCCTAGGAATTTGGGGCTGCTCTGGAAAGCTCAT CTGCACCACTACTGTGCCCTGGAACTCTAGTTGGAGTAATAAATCTCAGG AGGAC---ATATGGAATAACATGACCTGGCTGCAATGGGAGAAAGAAATT AGTAGTTACACAGGCATAATATATCAACTAATTGAGGAATCGCAGAACCA GCAGGAAAAGAATGAACTAGACTTATTGGCATTGGACAAGTGGGCAAATC TGTGAAATTGGTTTAACATCTCAAATTGGCTGTGGTATATTAGACTATTT GTAATAATAGTAGGAGGCTTAATAGGATTAAGAATAGTTTTTACTGTGCT TTCTATAATCAATAGAGTTAGGCAGGGATACTCACCTCTGTCGTTTCAGA CCCTTGCCCCAATCCCAGAG---GGTCTCGGCAGGCCAGGAAGAATCGAA GAAGAAGGTGGAGAGCAAGGCAAAGACAGATCGATTCGCTTAGTGAGCGG ATTCTTAGCGATTGCCTGGGACGACCTGCGGAACCTGTGCCTCTTCAGCT ACCACCGATTGAGAGACTTCGCCTTGATTGTAGCGAGAGCTGTGGAACTT CTGGGACGCAGCAGCCTCAAGGGACTGAGACTGGGG---TGGGAGGGCCT C------AAATATCTGTGGAAT---------------------CTTCTGC TGTATTGGGGTCGGGAACTAAAAATTAGTGCTATTACTTTGCTTGACGCT GTAGCAGTAGCAGTAGCTGGGTGGATAGATAGGGTTATAGAAATAGGACA AACAATTGGTAGAGCTATTCTCAACATACCTAGAAGAATCAGACAAGGCT TAGAAAGGGCTTTGCTATAA ; A-92UG037.1 ATGAGAGTGATGGGGATAGAGAGGAATTATCCTTGCTGGTGGACATGG-- ----------GGGATTATGATCTTGGGGATGATAATAATTTGTAATACTG CA---GAAAACTTGTGGGTTACTGTCTACTATGGGGTACCTATATGGAAG GATGCAAATACCACCTTATTTTGTGCATCAGATGCGAAAGCATATGATAC AGAAGTGCATAATGTCTGGGCTACGCATGCCTGTGTACCTACAGACCCCA GCCCACAAGAACTAAAGATGGAAAATGTGACAGAAGAGTTTAACATGTGG AAAAATAACATGGTAGAGCAGATGCATACAGATATAATCAGTCTATGGGA CCAAAGCCTAAAACCATGTGTACAGTTAACCCCTCTCTGCGTTACTTTAG ATTGTAGCTATAAC------ATCACCAATAATATCACC------------ ---------------AATAGCATCACC---------AATAGCTCAGTTAA CATGAGAGAAGAAATAAAAAACTGCTCTTTCAATATGACCACAGAATTAA GGGATAAGAATCGGAAGGTATATTCACTTTTTTATAAACTTGATGTAGTA CAAATTAATAATGGT---------------AATAACAGTAGTAAT----- -------------CTGTATAGATTAATAAATTGTAATACCTCAGCCCTTA CACAGGCTCGTCCAAAGGTAACCTTTGAGCCAATTCCCATACATTATTGT GCCCCAGCTGGTTATGCGATTCTAAAATGTAATGATAAGGAGTTCAATGG AACAGGGCTATGCAAGAATGTCAGCACAGTACAATGCACACATGGAATCA GGCCAGTAGTGTCAACTCAACTGCTGTTAAATGGCAGTTTAGCAGAAGGA AAGGTAATGATTAGATCTGAAAATATCACAAACAATGTCAAAAACATAAT AGTACAACTTAACGAGTCTGTAACAATTAATTGTACCAGACCTAACAATA ATACAAGAAGAAGTGTACGTATA---------GGACCAGGACAAACATTC TATGCA---ACAGGTGAT------ATAATAGGGGATATA---AGACAAGC ACATTGTAATGTCAGTGGGTCACAATGGAATAAAACTTTACACCAGGTAG TTGAACAATTAAGAAAA---------TATTGGAACAAC---------AAT ACA---------ATAATCTTTAATAGCTCCTCA---GGAGGGGATTTAGA AATTACAACACATAGTTTTAATTGTGCAGGAGAATTTTTCTATTGTAATA CATCAGGCCTGTTTAATAGTACTTGG---GTAAAT------------GGC ACTACCAGC------AGCACG---TCAAAT---GGCACT---------AT AACTCTCCCATGCAGAATAAAGCAAATTATAAATATGTGGCAGAGAGTAG GACAAGCAATGTATGCCCCTCCCATCCAAGGAGTAATAAAGTGTGAATCA AACATTACAGGACTAATATTAACAAGAGATGGTGGGGTTAAT---AGC-- ----AGTGACAGTGAAACCTTCAGACCTGGAGGAGGAGATATGAGGGATA ATTGGAGAAGTGAATTATATAAGTATAAGGTAGTAAAAATTGAACCACTA GGAGTAGCACCCACC---------AAGGCAAGGAGAAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTTACA---CTGGGAGCTGTATTCA TTGGGTTCTTAGGAACAGCTGGAAGCACAATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGAAAATTATTGTCTGGCATAGTGCAACAGCAAAG CAATTTGCTGAGGGCTATAGAGGCTCAACAGCATCTGTTGAAACTCACTG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAGGGATCAACAGCTCCTAGGAATTTGGGGCTGCTCTGGAAAACTCAT CTGCCCCACTAATGTGCCCTGGAACTCTAGTTGGAGTAATAAATCTCTAG ATGAA---ATATGGGAAAACATGACCTGGCTGCAATGGGATAAAGAAATT AGCAATTACACAATCAAAATATATGAGCTAATTGAAGAATCGCAGATCCA GCAGGAAAGGAATGAAAAAGACTTACTGGAGTTGGACAAGTGGGCAAGTC TGTGGAATTGGTTTGACATATCAAAATGGCTGTGGTATATAAAAATATTT ATAATGATAGTAGGAGGCCTAATAGGATTAAGAATAGTTTTTGCTGTGCT TTCTGTAATAAATAGAGTTAGGCAGGGATACTCACCCCTATCGTTTCAGA CCCATACCCCGAACCCAAGG---GGACTCGACAGGCCCGGAAGAATCGAA GAAGAAGGTGGAGAGCAAGACAGAGGCAGATCGATACGCTTAGTGAGCGG GTTCTTAGCACTTGCCTGGGACGACCTGCGGAACCTGTGCCTCTTCAGCT ACCACCGATTGAGAGACTTCATCTTGATTGCAGCGAGGACTGTGGAACTT CCGGGACACAGCAGTCTCAAGGGGTTGAGACTGGGG---TGGGAAGGACT C------AAGTATCTGGGGAAT---------------------CTCCTGT TGTATTGGGGTCGGGAACTAAAAATTAGTGCTATTAATTTGCTTGATACC ATAGCAATAGCAGTAGCTGGCTGGACAGATAGGGTTATAGAAACAGTACA AAGGCTTGGTAGAGCTATTCTCAACATACCTAGAAGAATCAGGCAGGGCT TCGAAAGGGCTTTACTATAA ; A-KENYA ATGAGAGTGATGGGGACACAGAGGAATTGTCAGCACTTATTGAGATGG-- ----------GGAACTATGATCTTGGGGATGATAATAATCTGTAGTGCTG CA---GAAAACTTGTGGGTTACTGTCTACTATGGGGTACCTGTGTGGAAA AACGCAGAGACCACCTTATTTTGTGCATCAGATGCTAAAGCATATGAAAC AGAAAAACATAATGTCTGGGCTACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAAATACATTTGGAAAATGTGACAGAAGAGTTTAACATGTGG AAAAATAACATGGTAGAGCAGATGCATACAGATATAATCAGTCTATGGGA TCAAAGCCTAAAGCCATGTGTTAAGTTAACCCCTCTCTGCGTTACCTTAA ATTGTAGCAATGTCAATGTC------------------------------ ---------------ACTGCCACGAGTGGCACAACA---------CACGG GGGACGGGGGAGAATGAAAAACTGCTCTTACAATATAACCACAGAGCTAA GGGATAGGAGACAGAAGGTATATTCACTTTTTTATAGACTTGATGTAGTA CCAATTAATGAA------------------AATAATAGCAGTAACAAT-- -------------GAGTATAGATTAATAAATTGTAATACCTCAGCCATTA CACAAGCTTGCCCAAAGGTAACCTTTGAGCCAATTCCCATACATTATTGT GCCCCAGCTGGTTTTGCGATCCTAAAGTGTAAAGATAAGAAGTTCAATGG AACAGGGCCATGCACGAATGTCAGCACAGTACAATGCACACATGGAATCA AGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGGA GAGGTAATGATTAGATCTGAAAATATCACAAACAATGCCAAAAATATAAT AGTACAATTTGCCGAGCCTGTAAAAATTAATTGTACCAGACCTAACAACA ATACAAGAATGAGTATACGTATA---------GGACCAGGACAAGCATTC TATGCA---ACAGGTGAC------ATAATAGGGAACATA---AGACAAGC ACATTGTAATGTCAGTAGAGCAGAATGGAATACAACTTTGCAAAAGGTAG TCACAAAATTAAGGGAA---------TACTTTGGGAACAAC------AAA ACA---------ATAAAATTTGCTAACTCCTCA---GGAGGGGATCTAGA AATCACAACACATAGTTTTAATTGTGGAGGAGAATTTTTCTATTGTAATT CATCAGGCCTGTTTAATAGCACTTGG---ACCAAC---------ATGCAG GAGTCAAATAGCACGGAG------------------TCAAATGACACTAT AACTCTCCCATGCAGAATAAAA---ATTATAAACATGTGGCAGAGAGCAG GACAAGCAATGTATGCCCCTCCCATCCAAGGAATAATAAAGTGTGTATCA AACATTACAGGACTAATATTAACAAGAGATGGTGGGGATAATAAC----- ----AGTGAAAGTGAAACCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAGTATAAAGTAGTAAAAATTGAACCACTA GGAGTAGCACCCACC---------AAGGCAAAGAGAAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTTGGA---ATAGGAGCTGTCTTCC TTGGGTTCTTAGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGGCATAGTGCAACAGCAAAG CAATTTGCTGAGGGCTATAGAGGCTCAACAACATCTGTTGAAACTCACGG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAGGGATCAACAGCTCCTAGGAATTTGGGGCTGCTCTGGAAAAATCAT CTGCACCACTAATGTGCCCTGGAACTCTAGTTGGAGCAATAAATCTCAGA GTGAG---ATATGGGAGAACATGACCTGGCTGCAATGGGATAAAGAAATT AGCAATTACACAGACATAATATATAATCTACTTGAAGAATCGCAGAACCA GCAGGAAAAGAATGAACAAGACTTATTGGCATTGGACAAGTGGGCAAATC TATGGAATTGGTTTGACATATCAAACTGGCTGTGGTATATAAAAATATTT ATAATGATAGTAGGAGGCTTAATAGGATTAAGAATAGTTTTTACTGTGCT TTCTATAATAAATAGAGTTAGGCAGGGATACTCACCCTTGTCGTTCCAGA CCCATACCCCAGCCCCAAGG---GGTCTCGACAGGCCCGAAAGAATCGAA GAAGAAGGTGGAGAGCAAGACAGAGACAGATCGATTCGATTAGTGACCGG ATTCTTAGCACTTGCCTGGGACGATCTACGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTCATCTTGATTGCCACTGAGACTGTGGAACTT CTGGGACACAGCAGTCTCAGGGGGTTGAGACTGGGG---TGGGAAGGCCT C------AAGTATCTGTGGAAT---------------------CTCCTGT TGTACTGGGGTCAGGAACTAAAAATTAGTGCTAGTAATTTGGTTGATACC ATAGCAATAGTAGTAGCTGGCTGGACAGATAGGGTTATAGAAATAGCACA AGGAATAGGTAGAGCTATTCTCCACATACCTAGAAGAATCAGACAGGGCT TTGAAAGAGCTTTGCTATAA ; A-SF170 ATGAGAGTGATGGGGATACAGATGAACTGTCAAAACTTATTGAGATGG-- ----------GGAACTATGATCTTGGGAATGTTAATAATCTGTAGTGCTA CA---AGCAAATTGTGGGTTACTGTCTATTATGGGGTACCTGTGTGGAAA GACGCAGAGACCACCTTATTTTGTGCATCAGATGCTAAAGCATATGAGAG AGAAGTGCATAATGTCTGGGCGACACATGCCTGTGTACCCACAGACCCCG ACCCACAAGAAATATATTTGGAAAATGTGACAGAAGGGTTTAACATGTGG AAAAATAACATGGTAGAGCAGATGCATACAGATATAATCAGTCTATGGGA CCAGAGTCTAAAGCCATGTGTAAAGTTAACCCCTCTCTGCGTTACTTTAA ATTGTAGCCAT------------------AACATCACCACCCATAACATC ACCACCAACAACCCCAATATCACCAAATAC---------------ATGGA A------GGAGAAATAAAGAACTGCTCTTACAATATGACCACAGAACTAA GGGATAAGAAACAGAAAGTGTATTCACTTTTTTATAAACTTGATGTAGTA CCAATTGATAAA------------------AATAATGGTAATAACAATAT AAGGACT------CAGTATAGATTAATAAATTGTAATACCTCAGCCATTA CACAGGCTTGTCCAAAAGTATCCTTTGAGCCAATTCCCATACATTATTGT GCTCCAGCTGGTTTTGCGATTCTAAAGTGTAATGATGCAGAGTTCAATGG AACAGGGCCATGCAAGAATGTCAGCACAGTACAATGCACACATGGAATCA GGCCAGTAATATCAACCCAACTGCTGTTAAATGGCAGTCTAGCAGAAGGA AGGGTAAAGATTAGATCTGAAAATATCACAAACAATGCCAAAACCATAAT AGTACAACTTAACAAGACTGTAGAAATTAATTGTACCAGACCTAACAACA ATACAAGAAAAAGTGTACGTATA---------GGACCAGGACAAGCATTC TATGCA---ACAGGTGAC------ATAATAGGGGATATA---AGACAAGC ATATTGTAATGTCAGTAGAGCAGACTGGAATAAAACTTTACAAGGGGTAG CCAACCAATTAAAAAGT---------TACTTTAGTAAC---------AAA ACA---------ATAATCTTTGCTAGCTCCTCA---GGAGGGGATTTAGA AATTACAACACATAGTTTTAATTGTGGAGGAGAATTTTTTTATTGTGATA CATCAGGCCTGTTTAATAGCACATGGGGGGGAAAT------------AGC ACTGACAGCATACAGGAGTCAAATAGCACAGAGTCAAAT---GACACTAT AATTCTCCCATGCAGAATAAAGCAAATTATAAATATGTGGCAGAGAGTAG GACAAGCAATGTATGCCCCTCCCATCCAAGGAGTAATAAAGTGTATATCA AATATTACAGGACTTCTATTAACAAGAGATGGTGGGGATAATAAC----- ----AGTGCAAATGAAACCTTCAGACCTACAGGAGGAAATATGAGGGACA ATTGGAGAAGTGAATTATATAAGTATAAAGTAGTAAAAATTGAACCACTA GGAGTAGCACCCACC---------CCGGCAAAGAGAAGA------GTGGT G---CAGAGAGAAAAAAGAGCA---GTTGGA---ATAGGAGCTGTATTCA TTGGGTTCTTAGGAGCAGCCGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCTAGACAATTATTGTCTGGCATAGTGCAACAGCAAAG CAATTTGCTGAGGGCTATAGAGGCTCAACAACATCTGTTGAAACTCACGG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAAGGATCAACAGCTCCTAGGAATTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTAATGTGCCCTGGAACTCTAGTTGGAGTAATAGAACTCAGA GTGAG---ATATGGAATAACATGACCTGGCTGCAATGGGATAAAGAAATT AGCAATTACACAGACATAATATATAATCTAATTGAAGAATCGCAGATCCA GCAGGAAAAGAATGAACAAGAATTATTGGCATTGGACAAGTGGGCAAATC TGTGGAATTGGTTTGACATATCAAAGTGGCTGTGGTATATAAGGATATTT ATAATGATAGTAGGAGGCTTAATAGGATTAAGAATAGTTTTTGCTGTGCT TTCTATAATAAATAGAGTTAGGCAGGGATACTCACCTCTGTCATTTCAGA TCCATACCCCAAACCCAAGG---GGTCCCGACAGGCCCGAAAGAATCGAA GAAGAAGGTGGAGAGCAAGGCAGAGACAGATCGATTCGATTAGTGAGCGG ATTCTTAGCACTTGCCTGGGACGACCTGCGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTCATCTTGATTGCAGCGAGGACCGTGGAACTT CTGAAACGCAGCAGTCTCAGGGGGCTGAGACTGGGG---TGGGAAGGCCT C------AAGTACCTGTGGAAT---------------------CTTCTGC TATATTGGGGTCGGGAACTAAAAAATAGTGCTATTAATTTGCTTGATACC ATAGCAATAGCAGTAGCTGGCTGGACAGATAGGGTTATAGAAATAGGACA GGCAATTTGTAGAGCTATTCTCAACATACCTAGAAGAAT----------- -------------------- ; B-HXB2 ATGAGAGTGAAGGAG------AAA---TATCAGCACTTGTGGAGATGGGG GTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTA CA---GAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAG GAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATAC AGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAACATGTGG AAAAATGACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGA TCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTAGTTTAA AGTGCACTGATTTG------------AAGAATGATACTAATACC------ ---------------AATAGTAGTAGC---------GGGAGAATGATAAT GGAGAAAGGAGAGATAAAAAACTGCTCTTTCAATATCAGCACAAGCATAA GAGGTAAGGTGCAGAAAGAATATGCATTTTTTTATAAACTTGATATAATA CCAATAGATAAT---------------------------------GATAC TACC---------AGCTATAAGTTGACAAGTTGTAACACCTCAGTCATTA CACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGT GCCCCGGCTGGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAATGG AACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTA GGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAA GAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAAT AGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACA ATACAAGAAAAAGAATCCGTATCCAGAGA---GGACCAGGGAGAGCATTT GTTACA---ATAGGAAAA---------ATAGGAAATATG---AGACAAGC ACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAG CTAGCAAATTAAGAGAA---------CAATTTGGAAATAAT------AAA ACA---------ATAATCTTTAAGCAATCCTCA---GGAGGGGACCCAGA AATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATT CAACACAACTGTTTAATAGTACTTGG---TTTAATAGTACTTGG---AGT ACTGAAGGGTCAAATAACACTGAAGGAAGT---GACACA---------AT CACCCTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGAAAGTAG GAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATTAGATGTTCATCA AATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGC---AAC-- ----AATGAGTCCGAGATCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTA GGAGTAGCACCCACC---------AAGGCAAAGAGAAGA------GTGGT G---CAGAGAGAAAAAAGAGCA---GTGGGA---ATAGGAGCTTTGTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACG CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAA CAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAG TCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATAC CTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCAT TTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGG AACAG---ATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATT AACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCA GCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTT TGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTC ATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACT TTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGA CCCACCTCCCAACCCCGAGG---GGACCCGACAGGCCCGAAGGAATAGAA GAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGG ATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTT CTGGGACGCAGG---------------------GGG---TGGGAAGCCCT C------AAATATTGGTGGAAT---------------------CTCCTAC AGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAATGCC ACAGCCATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAGTAGTACA AGGAGCTTGTAGAGCTATTCGCCACATACCTAGAAGAATAAGACAGGGCT TGGAAAGGATTTTGCTATAA ; B-JRFL ATGAGAGTGAAGGGGATCAGGAAGAGTTATCAGTACTTGTGGAAAGGG-- ----------GGCACCTTGCTCCTTGGGATATTAATGATCTGTAGTGCTG TA---GAAAAGTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAA GAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATAC AGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAAGTAGTATTGGAAAATGTAACAGAACATTTTAACATGTGG AAAAATAACATGGTAGAACAGATGCAGGAGGATATAATCAGTTTATGGGA TCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTACTTTAA ATTGCAAGGATGTG---------------AATGCTACT------------ ---------------AATACCACTAATGAT---AGCGAGGGAACGATGGA G---AGAGGAGAAATAAAAAACTGCTCTTTCAATATCACCACAAGCATAA GAGATGAGGTGCAGAAAGAATATGCTCTTTTTTATAAACTTGATGTAGTA CCAATAGATAAT------------------AATAATACC----------- -------------AGCTATAGGTTGATAAGTTGTGACACCTCAGTCATTA CACAGGCCTGTCCAAAGATATCCTTTGAGCCAATTCCCATACATTATTGT GCCCCGGCTGGTTTTGCGATTCTAAAGTGTAATGATAAGACGTTCAATGG AAAAGGACCATGTAAAAATGTCAGCACAGTACAATGTACACATGGAATTA GGCCAGTAGTATCAACTCAACTGCTGCTAAATGGCAGTCTAGCAGAAGAA GAGGTAGTAATTAGATCTGACAATTTCACGAACAATGCTAAAACCATAAT AGTACAGCTGAAAGAATCTGTAGAAATTAATTGTACAAGACCCAACAACA ATACAAGAAAAAGTATACATATA---------GGACCAGGGAGAGCATTT TATACT---ACAGGAGAA------ATAATAGGAGATATA---AGACAAGC ACATTGTAACATTAGTAGAGCAAAATGGAATGACACTTTAAAACAGATAG TTATAAAATTAAGAGAA---------CAATTTGAGAAT---------AAA ACA---------ATAGTCTTTAATCACTCCTCA---GGAGGGGACCCAGA AATTGTAATGCACAGTTTTAATTGTGGAGGAGAATTTTTCTACTGTAATT CAACACAACTGTTTAATAGTACTTGGAAT---AAT------------AAT ACTGAAGGGTCA---------AATAACACTGAAGGAAAT------ACTAT CACACTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGGAAGTAG GAAAAGCAATGTATGCCCCTCCCATCAGAGGACAAATTAGATGTTCATCA AATATTACAGGGCTGCTATTAACAAGAGATGGTGGTATTAATGAG----- ----AATGGGACCGAGATCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTA GGAGTAGCACCCACC---------AAGGCAAAGAGAAGA------GTGGT G---CAAAGAGAAAAAAGAGCA---GTGGGA---ATAGGAGCTGTGTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACA CTGACGGTACAGGCCAGACTATTATTGTCTGGTATAGTGCAACAGCAGAA CAATTTGCTGAGGGCTATTGAGGCGCAACAGCGTATGTTGCAACTCACAG TCTGGGGCATCAAGCAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAGGGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCAT TTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGG ATAGG---ATTTGGAATAACATGACCTGGATGGAGTGGGAAAGAGAAATT GACAATTACACAAGCGAAATATACACCCTAATTGAAGAATCGCAGAACCA ACAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTT TGTGGAATTGGTTTGACATAACAAAATGGCTGTGGTATATAAAAATATTC ATAATGATAGTAGGAGGCTTAGTAGGTTTAAGACTAGTTTTTACTGTACT TTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCATTATCGTTTCAGA CCCTCCTCCCAGCCCCGAGG---GGACCCGACAGGCCCGAAGGAATCGAA GAAGAAGGTGGAGAGAGAGACAGAGACAGATCCGGACGATTAGTGAACGG ATTCTTAGCACTTATCTGGGTCGACCTGCGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTACTCTTGACTGTAACGAGGATTGTGGAACTT CTGGGACGCAGG---------------------GGG---TGGGAAGTCCT G------AAATATTGGTGGAAT---------------------CTCCTAC AGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAATGCC ACAGCCATAGCAGTAGCTGAGGGGACAGATAGGATTATAGAAGCATTACA AAGAACTTATAGAGCTATTCTCCACATACCTACAAGAAT----------- -------------------- ; B-OYI ATGACAGCGAGGGGGACCAGGAAGAATTATCAGCGCTTGTGGAGATGG-- ----------GGCACCATGCTCCTTGGGATGTTGATGATATGTAGTGCTG CA---GAAAATTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAA GAAGCAACCACCACTCTATTCTGTGCATCAGATGCTAGAGCATATGCTAC AGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAAGTAGTATTGGGAAATGTGACAGAAAATTTTGACATGTGG AAAAATAATATGGTAGAACAAATGCAAGAAGATATAATCAGTTTATGGGA TCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTACTTTAG ATTGCACTGATGTTAATACCACTAGTAGTAGTTTGAGGAATGCTACTAAT ACC------------ACAAGTAGTAGT---------TGGGAAACG---AT GGAGAAAGGAGAATTAAAAAACTGCTCTTTCAATACCACCACAAGCATAA GAGATAAGATGCAGGAACAATATGCACTTTTTTATAAACTTGATGTATTA CCAATAGATAAG---------------------------------AATGA TACT---------AAATTTAGGTTAATACATTGTAACACCTCAACCATTA CACAGGCCTGTCCAAAGATATCCTTTGAGCCAATTCCCATGCATTATTGT ACTCCGGCTGGTTTTGCGATTCTAAAGTGTAATGATAAGAAGTTCAATGG AACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTA AGCCAGTAGTGTCAACTCAACTGCTGTTAAATGGCAGCCTAGCAGAAGAA GAGGTAATAATTAGATCTAGCAATTTCACAAACAATGCTAAAATCATAAT AGTACAGCTGAATAAATCTGTAGAAATTAATTGTACAAGACCCAACAACA ATACAAGAAACAGGATATCAATA---------GGACCAGGGAGAGCATTT CATACA---ACAAAACAA------ATAATAGGAGATATA---AGACAAGC ACATTGTAACCTTAGTAGAGCAACATGGGAGAAAACTTTAGAACAGATAG CTACAAAATTAAGAAAA---------CAATTTAGGAAT---------AAA ACA---------ATAGCCTTTGATCGATCCTCA---GGAGGGGATCCAGA AATTGTAATGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATA CATCACAACTGTTTAATAGTACTTGG------AAT------------GAT ACTACAAGGGCAAATAGCACTGAAGTAACT------------------AT CACACTCCCATGTAGAATAAAACAAATTGTAAACATGTGGCAGGAAGTAG GAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATTAGATGTTCATCA AAGATTACAGGGCTGCTATTAACAAGAGATGGTGGTAAGAAC---ACC-- -ACGAACGGGATCGAAATCTTCAGACCTGCAGGAGGAGACATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTA GGAGTAGCACCCACC---------AAGGCAAGGAGAAGA------GTGGT G---CAGAGAGAAAAAAGAGCA---GTGGGAATGCTAGGAGCTATGTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCACGGTCGATGACG CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAA CAATCTGCTGAGGGCTATTGAGGCGCAACAGCACCTGTTGCAACTCACAG TCTGGGGCATCAAGCAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAAGGATCAACAGCTCCTAGGGATTTGGGGTTGCTCTGGAAAGCTCAT TTGCACCACTACTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGA ATGAG---ATTTGGGATAACATGACCTGGATGCAGTGGGAAAGAGAAATT GACAATTACACACACTTAATATACACCTTAATTGAAGAATCGCAGAACCA ACAGGAAAAGAATGAACAAGAATTATTGGAATTGGATAAGTGGGCAGGTT TGTGGAGTTGGTTTAGCATAACAAACTGGCTGTGGTATATAAGAATATTC ATAATAATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACT TTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCATTATCGTTTCAGA CCCGCCTCCCAACCCAGAGG---GGACCCGACAGGCCCGAAGGAATCGAA GAAGAAGGTGGAGAGAGAGACAGAGACAGATCCGGAAGATTAGTGGATGG ATTCTTAGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTAATCTTGATTGTAGCGAGGATTGTGGAACTT CTGGGACGCAGG---------------------GGG---TGGGAAGTCCT G------AAATATTGGTGGAAT---------------------CTCCTGC AGTATTGGAGCCAGGAACTAAAGAATAGTGTCATTAGCTTGCTCAACGCC ACAGCTATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAATAGTACA AAGAGCTTATAGAGCTTTTCTCAATATACCTAGAAGAATAAGACAGGGCT TGGAAAGGGCTTTGCTATAA ; B-RF ATGAGAGTGATGGAGATGAGGAAGAATTGTCAGCACTTGTGGAAATGG-- ----------GGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTG CA---GAGGACTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAA GAAGCAACCACCACTCTATTTTGTGCATCAGAAGCTAAAGCATATAAAAC AGAGGTACATAATGTCTGGGCCAAACATGCTTGTGTACCTACAGACCCCA ACCCACAAGAAGTACTATTGGAAAATGTGACAGAAAATTTTAACATGTGG AAAAATAACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGA TCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTACTTTAA ATTGCACTGATGCT---------AACTTGAATGGTACTAATGTC------ ---------------ACTAGTAGTAGC---------GGGGGAACAATGAT GGAGAACGGAGAAATAAAAAACTGCTCTTTCCAAGTTACCACAAGTAGAA GAGATAAGACGCAGAAAAAATATGCACTTTTTTATAAACTTGATGTGGTA CCAATAGAGAAGGGTAATATTAGCCCTAAGAATAATACTAGCAATAATAC TAGCTAT---GGTAACTATACATTGATACATTGTAATTCCTCAGTCATTA CACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGC ACCCCGGCTGGTTTTGCGATTCTAAAGTGTAATGATAAGAAGTTCAATGG AACAGGACCATGTAAAAATGTCAGCACAGTACAATGTACACATGGAATTA GGCCAGTAGTGTCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAA GAGGTAGTAATTAGATCTGAAAATTTCACGGACAATGTTAAAACCATAAT AGTACAGCTGAATGCATCTGTACAAATTAATTGTACAAGACCCAACAACA ATACAAGAAAAAGTATAACTAAG---------GGACCAGGGAGAGTAATT TATGCA---ACAGGACAA------ATAATAGGAGATATA---AGAAAAGC ACATTGTAACCTTAGTAGAGCACAATGGAATAACACTTTAAAACAGGTAG TTACAAAATTAAGAGAA---------CAATTTGACAAT---------AAA ACA---------ATAGTCTTTACGTCATCCTCA---GGAGGGGACCCAGA AATTGTACTTCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATA CAACACAACTGTTTAATAGTACTTGG------AAT------------AGT ACTGAAGGGTCAAATAACACTGGAGGAAAT---GACACA---------AT CACACTCCCATGCAGAATAAAACAAATTGTAAACATGTGGCAGGAAGTAG GAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATTAAATGTATATCA AATATTACAGGGCTACTATTAACAAGAGATGGGGGTGAAGAT---ACA-- -ACTAATACTACAGAGATCTTCAGACTTGGAGGAGGAAATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTGGTAAGAATTGAGCCATTA GGAGTGGCACCCACT---------AGGGCAAAGAGAAGA------GTGGT G---CAAAGAGAAAAAAGAGCA---GTGGGAACAATAGGAGCTATGTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGGCTCAATAACG CTAACGGTACAGGCCAGACACTTATTGTCTGGTATAGTGCAACAGCAAAA CAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACGG TCTGGGGCATCAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAGGGATCAACAGCTCCTAGGAATTTGGGGATGCTCTGGAAAACTCAT TTGCACCACTACTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGA ATATG---ATTTGGAATAACATGACCTGGATGCAGTGGGAAAGAGAAATT GACAATTACACAGGCATAATATACAACTTACTTGAAGAATCGCAGAACCA GCAAGAAAAGAATGAACAAGAATTATTGGAATTGGATAAATGGGCAAATT TGTGGAATTGGTTTGACATAACACAATGGCTGTGGTATATAAGAATATTC ATAATGATAGTAGGAGGCTTGGTAGGTCTAAAAATAGTTTTTGCTGTGCT TTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCATTATCATTTCAGA CCCACCTCCCAGCCCCGAGG---GGACCCGACAGGCCCGAAGGAATCGAA GGAGAAGGTGGAGAGAGAGACAGAGACAGATCCGGCGGTGCAGTGAATGG ATTCTTGACACTTATCTGGGACGATCTGTGGACCCTGTGCAGCTTCAGCT ACCACCGCTTGAGAGACTTACTCTTGATAGTAGTGAGGATTGTGGAACTT CTGGGACGCAGG---------------------GGG---TGGGAAGCCCT C------AAGTATTGGTGGAAT---------------------CTCCTGC AGTATTGGAGTCAGGAGCTAAAGAATAGTGCTGTTAGCTTGCTTAATACC ACAGCAATAGCAGTAGCTGAAGGGACAGATAGGATTATAGAAGTAGCACA AAGAATTCTTAGAGCTTTTCTTCACATACCTAGAAGAATAAGACAGGGCT TAGAAAGGGCTTTGCTGTAA ; C-ETH2220 ATGAAAGTGATGGGGATACAGAGGAATTGTCAACAATGGTGGATATGG-- ----------GGAATCTTAGGCTTTTGGATGTTAATGATTTGTAATGGAA TG---GGGAACTTGTGGGTCACAGTCTATTATGGGGTACCTGTATGGAAA GATGCTAGCCCTACTCTATTTTGTGCATCAGATGCTAAAGCATATGATAC AGAAGTACATAATGTCTGGGGTACATTTGCCTGTGTCCCCACAGACCCCA GCCCACAAGAATTGGGTTTGGAAAATGTGACAGAAAATTTTAACATGTGG AAAAATGACATGGTGGAGCAGATGCATCAGGATATAATCAGTTTATGGGA TCAAGGCCTAAAGCCATGTGTAAAGTTGACCCCACTCTGTGTTACTTTAA ACTGTAATGCTATC------------AAAAACAATACTAAGGTTACA--- ------------AATAATAGTATCAAT---------AGT---GCC----- ----AATGATGAAATGAAAAATTGTTCTTTCAATATAACCACAGAACTAA GAGATAAGAAAAGGAAGGCATATGCACTTTTTTATAAACTTGATATAGTA CCACTTAATAAC------------------------GGTTCTACT----- -------------GATTATAGATTAATAAATTGTAATACCTCAACCATAA CACAAGCCTGTCCAAAGGTCTCTTTGGACCCAATTCCTATACATTATTGT GCTCCAGCTGGTTATGCGATTCTAAAGTGTAGAGATAAGACATTCACTGG AACAGGACCATGCCATAATGTCAGCACAGTACAATGCACACATGGAATTA AACCAGTGGTATCAACTCAACTATTGTTAAATGGTAGTATAGCAGAAGGT GAGACAATAATTAGATTTGAAAATCTGACAAACAATGCCAAAATAATAAT AGTACAGCTTAATGAATCTGTAGAAATTACTTGTACGAGACCCAGCAATA ATACAAGAGAAAGTATAAGGATA---------GGACCAGGACAAACATTC TATGCA---ACAGGAGAC------ATAATAGGAGATATA---AGACAAGC ACATTGTAACATTAGTGAAGAAAAATGGAATAAAACTCTACAAAAGGTAA AGGAAAAATTACAAAAG---------CACTTCCCTAAT---------AAA ACA---------ATAGAATTTAAGCCATCCTCA---GGAGGGGACCTAGA AATTACAACACATAGCTTTAATTGTGGAGGAGAATTTTTCTATTGCAATA CATCAAACCTGTTTAATAGCACAAAACTA------------------GAA CTGTTTAAT---AGCAGTACAAATTTAAAC------------------AT CACACTCCAATGCAGAATAAAACAAATTATAAACATGTGGCAGGGAGTAG GACGAGCAATGTATGCCCCTCCCATTGAAGGAATAATAATGTGTAGATCA AATATCACAGGACTACTACTGACACGTGATGGAGCCAAAGAGCCACAT-- ----AGCACAAAAGAGATATTCAGACCTGAAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTGGTAGAAATTAAGCCACTA GGAGTAGCACCCACT---------AAGCCAAAAAGGAGA------GTGGT G---GAGAGAGAAAAAAGAGCA------GCA---CTAGGAGCTTTGTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCATCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCGGGTATAGTGCAACAGCAAAG CAATTTGCTGAAAGCTATAGAGGCGCAACAGCATATGTTGCAGCTCACGG TCTGGGGCATTAAGCAGCTCCAGACAAGAGTCCTGGCTATAGAAAGACAC CTAAGGGATCAACAGCTCCTAGGGATTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTGCTGTGCCTTGGAACTCTAGTTGGAGTAATAAGTCTCAAG AGGAG---ATTTGGGATAACATGACCTGGATGCAGTGGGATAGAGAAATT AGTAATTATACAGACATAATATACAATTTGCTTGAAGTCTCGCAAAACCA GCAGGACAAAAATGAAAAAGATTTACTAGCATTGGACAAATGGGAAAATC TGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAAATATTC ATAATGATAGTGGGAGGTGTGATAGGTTTAAGAATAATTTTTGCTGTGCT TTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCATTATCGTTTCAGA CCCTTATCCCACACCCGAGG---GGACCCGACAGGCTCGGAGGAATCGAA GAAGAAGGTGGAGAGCAAGGCAGAGACAGATCCATACGCTTAGTGAACGG ATTCTTAGCAATTTTTTGGGACGACCTGCGGAGCCTGTGCCTCTTCAGTT ACCACCGCTTGAGAGACTTAATCTTGATTGCAGCGAGGACAGTGGAACTT CTGGGACGCAGCAGTCTCAAGGGACTACAGAGGGGG---TGGGAAACCCT T------AAATATCTGGGAAGC---------------------CTTGTGC AGTATTGGGGTCTGGAGCTAAAAAAGAGTGCTATTAATCTGCTTAATACC ACAGCAATAGTAGTAGGTGAAGGAACAGATAGATTTATAGAATTAATACA AAGAATTTGGAGAGCTTTCTGCAACATACCTAGAAGAATAAGACAGGGCT TGGAAGCAGCTTTGCAATAA ; C-92BR025.8 ATGAGAGTGGAGGGGATACAGAGGAATTGGAAACAATGGTGGATATGG-- ----------GGCATCTTAGGCTTTTGGATGGTAATGATTTATAATGTAA GG---GGGAACTTGTGGGTCACGGTATATTATGGGGTACCTGTGTGGAAA GAAGCAAAAACTACTCTATTTTGTGCATCAGACGCTAAAGCATATGATGC AGAAGTGCATAATGTCTGGGCTACACATGCCTGTGTACCCACAGACCCCA ATCCACAAGAAATGGTTTTGGAAAATGTAACAGAAAATTTTAACATGTGG GAAAATGACATGGTGGAACAGATGCATCAGGATATAATCAGCTTATGGGA TCAAAGCCTAAAGCCATGTGTAAAGTTGACCCCACTCTGTGTTACGTTAC ACTGCAGTAAC---------------------AGAACTATTGACTACAAT ---------------AACAGAACTGAT---------AAC----------- -ATGGGGGGAGAAATAAAAAATTGTTCTTTCAATATGACCACAGAAGTAA GAGATAAGAGAGAGAAGGTACATGCACTTTTTTATAGACTTGATATAGTA CCACTTAAGAATGAG---------------------AGTAGTAACACTTC TGGT---------GATTATAGATTAATAAATTGTAATACCTCAGCCATAA CACAAGCCTGTCCAAAGGTCTCTTTTGACCCAATTCCTATACATTATTGT GCTCCAGCGGGTTATGCGATTCTAAAGTGTAATAATAAGACATTCAATGG AACAGGACCATGCAATAATGTCAGCACAATACAGTGTACACATGGAACTA AGCCAGTAGTGTCAACTCAACTACTGTTAAATGGTAGTCTAGCAGAAGAA GAGATAATAATTAGATCTAAAAATCTAACAGACAATGTCAAAACAATAAT AGTACATCTTAACGAATCTGTAGAGATTAATTGTACGAGACCCAACAATA ATACAAGAAAAAGTATAAGGATA---------GGACCAGGACAAGCATTC TATGCA---ACAGGAGAA------ATAATAGGAGATATA---AGACAAGC ACATTGTAACATTAGTAGAACAGCATGGAACAAAACTTTACAAGAGGTAG GTAAAAAATTAGCAGAG---------CACTTCCCTAAT---------AAA GCA---------ATAAAATTTGCAAAGCACTCA---GGAGGAGACCTAGA AATTACAACACATAGCTTTAATTGTAGAGGAGAATTTTTCTATTGCAATA CATCAAGCCTGTTTAATAGTACATAC---------ACACCT------AAT AGTACAGAA---AACATTACTGGAACAGAAAATTCAATC---------AT CACAATCCCATGCAGAATAAAACAAATTATAAATATGTGGCAGGGGGTCG GACGAGCAATGTATGCCCCTCCCATTGAAGGAATATTAACATGTAGATCA AATATCACAGGATTACTACTGACACGGGATGGAGGTACAGGT---ATG-- ----CATGACACAGAGATATTCAGGCCTGAAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTGGTAGAAATTAAACCATTA GGAATAGCACCCACT---------AAGGCGAAAAGGAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTGGGA---ATAGGAGCTGTGTTCC TTGGGTTCCTGGGAGCAGCAGGAAGCACTATGGGCGCAGCATCAATAACG CTGACGGTACAGGTCAGACAATTATTGTCTGGGATAGTGCAACAGCAAAG CAATTTGCTGAGAGCTATAGAGGCGCAACAGCATATGTTGCAACTCACGG TCTGGGGCATTAAGCAGCTTCAGACAAGAGTCCTGGCTATAGAAAGGTAC CTAAGGGATCAACAGCTCCTAGGGATTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTGCTGTGCCTTGGAATTCTAGTTGGAGTAATAGATCTCAAG AGGAT---ATTTGGAATAACATGACCTGGATGCAGTGGGATAGAGAAATT AGTAATTACACAAACACAATATACAGGTTGCTTGAAGACTCGCAAAACCA GCAGGAAAAAAATGAACAGGACTTATTAGCATTGGACAAGTGGCAAAATC TGTGGACTTGGTTTGGCATAACAAATTGGCTGTGGTATATAAAAATATTC ATAAAGATAGTAGGAGGCTTGATAGGTTTAAGAATAATTTTTGCTGTGCT CTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCCTTGTCGTTTCAGA CCCTTACCCCAAACCCGAGG---GGACCAGACAGGCTCGGAGGAATCGAA GAAGAAGGTGGAGAGCAAGACAGAGACAGATCCATTCGATTAGTGAGCGG ATTCTTAGCACTTGCGTGGGACGACCTGCGGAGCCTGTGCCTTTTCAGCT ACCACCGATTGAGAGACTTAATATTAATTGCAGCGAGAGCGGTGGAACTT CTGGGACGCAGCAGCCTCAGGGGAATACAGAGAGGG---TGGGAAATCCT T------AAGTATTTGGGAGGC---------------------CTTGTGC AGTATTGGAGTCTAGAGTTAAAAAAGAGTGCTATTAGTCTGTTTGATACC ATAGCAATAGCAGTAGCTGAAGGAACAGATAGGATTATAGAAGTCATACA AGGAATTTGGAGAGCTATCTGCAACATACCTAGAAGAATACGACAGGGCT TTGAAGCAGCTTTGCAATAA ; C-UG268 ATGAGAGTGATGGGGATACAGAGGAATTGTCAACAATGGTGGATATGG-- ----------GGAATCTTAGGCTTTTGGATATTAATGATTTGTAATGTGA TGGGGAAC---TTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAA GAAGCAACAACTACTCTATTTTGTGCATCAGATGCTAAAGCATATGAGAC AGAAGTGCATAATGTCTGGGCTACACATGCCTGTGTCCCCACAGACCCCA ACCCACAAGAAATAGTTCTGGAAAATGTAACAGAAAGTTTTAACATGTGG AAAAATGACATGGTGGATCAGATGCATCAGGATGTAATCAGTCTATGGGA TCAAAGCCTAAAGCCATGTGTAAAGTTGACCCCACTCTGTGTTACTTTAA ATTGTACAAATGTTAATGTTAATATTACCAATAATGCTAATGCTACCAAT AGCCCCTACGAAAATGGGAAA------------------------CTCAT GGAACAGGGAGAAATAAAAAATTGCTCTTTCAATGTAACCACAGAAATAA GAGATAAGAAACAGACAGCGCATGCACTTTTTTATAAACTTGATGTAGTA TCACTTGAAGGG---------------------AATAGTAACACT----- ----------------TACAGATTAATAAATTGTAATACCTCAGCCATAA CGCAAGCCTGTCCAAAGGTCACTTTGGACCCAATTCCTATACATTATTGT GCTCCAGCTGGTTATGCGATTCTAAAGTGTAATAATAAAACATTTAATGG AACAGGACCATGTAATAATGTCAGCACAGTACAATGTACACATGGAATTA AACCAGTGATATCAACTCAACTATTGTTAAATGGTAGTATAGCAGAAGAA GAAATAATAATTAGATCTGAAAATCTGACAAATAATGCCAAAATAATAAT AGTACAGCTTAACAAATCTGTAGAAATTAATTGTGCGAGACCCAACAATA ATACAAGAGAAAGTATAAGGATA---------GGACCAGGACAAACATTC TATGCA---ACAGGAGAC------ATAATAGGAGATATA---AGACAAGC ATACTGTAACATTAGTAGAAATGAATGGAATATAACTTTACAATGGGTAA GAGAAAAATTAAAAAGG---------CACTTCCCTAAT---------AAA ACA---------ATAAACTTTACTCAACCCTCA---GGAGGGGACTTAGA AATTACAACACATAGCTTTAATTGTAGAGGAGAATTTTTCTATTGCAATA CATCAAGCCTGTTTAATAGTAGTGATAATAATAAT---------AGTACC ---------------------------------------------ATCAT CACACTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGGGGGTAG GACGAGCAATGTATGCCCCTCCCATTAAAGGAAAAATAACATGTAGATCA AATATCACAGGACTACTACTGACACGTGATGGAGGGGAGACAAGT---GA GACAAATAGCACAGAGACATTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTGGTAGAAGTTAAGCCACTA GGAGTAGCACCCACT---------AAGGCAAAAAGGAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTGGGA---ATAGGAGCTGTGTTCC TTGGGTTCTTGGGAGCCGCAGGAAGCACTATGGGCGCAGCATCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAA CAATTTGCTGAGGGCTATAGAGGCGCAACAGCATATGTTGCAACTCACGG TCTGGGGCATTAAGCAGCTCCAGACAAGAGTCCTGGCTATAGAAAGATAC CTACAGGATCAACAGCTCCTAGGGATTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTGCTGTGCCTTGGAACTCTAGTTGGAGTAATAAATCTCTAG GGGAT---ATTTGGGATAACATGACCTGGATGCAGTGGGATAGAGAAATT AGTAATTATACAGGAACAATATACAGGTTGCTTGAAGACTCACAAAACCA GCAGGAGAAAAATGAAAAAGATTTACTAGCATTGGACAAATGGCAAAATC TGTGGAGTTGGTTTGACATAACAAAATGGCTGTGGTATATAAAAATATTC ATAATGATAGTAGGAGGCTTAATAGGTTTAAGAATAATTTTTGCTGTGCT CTCTATAGTGAATAGAGTTAGGAAGGGATACTCACCATTATCGTTTCAGA CCCTTACCCCAACCCCGAGG---GGACCCGACAGGCCCGGAGAAATCGAA GAAGAAGGTGGAGAGCAAGACAGAGACAGATCCGTGAGATTAATCAGCGG ATTCTTAGCACTTGCCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCT ACCGCCGCTTGAGAGACTTACTATTGATTGCAGCGAGAGCAGTGGAACTT CTGGGACGCAGCAGTCTCAGGGGACTACAGAGGGGG---TGGGAAGCCCT T------AAGTATCTGGGAAGC---------------------CTTGTGC AGTATTGGGGTCAAGAACTAAAAAAGAGTGCTATTAGTTTGCTTGATACC ATAGCAATAGCAGTATCTGAAGGAACAGATAGAATTATAGAAGTGGGACA AGGAATTGGGAGAGCTATCCTCCACATACCTAGAAGAATAAGACAAGGCT TTGAAGCAGCTTTGCAATAA ; C-ZAM18 ATGAGAGTGAGGGAGATACTGAGGAATTGGCAACAATGGTGGATATGG-- ----------GGCATCTTAGGCTTTTGGATGGTAATGAACTATAATGTGG TAGGAGACAACTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAA GAAGCAAAAACTACTTTATTCTGTGCATCAGATGCTAAAGCATATGAGAG AGAAGTGCATAATGTCTGGGCTACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAAATAGTTTTGGGAAATGTAACAGAAAATTTTAACATGTGG AAAAATGACATGGTGGATCAGATGCATGAGGATATAATCAGGTTATGGGA TCAAAGCTTAAAGCCATGTGTAAAGTTGACCCCACTCTGTGTCACTTTAG AATGTGGAAATGTT---------------AATGTTACCCATGAG------ ---------------AATAGCACG-------------------------- ----AAGGGGGAAATGAAAAATTGCTCTTTCAATGCAACCACAGAACTAA AAGATAAAAAACAGAGAGTGTATGCACTTTTTTATAAACTTGATATAGTA CCACTTAATGAGAAT---------------AACAACTCTAGTGAGGAC-- -TCTAGT------GAGTATAGATTAATAAATTGTAATACCTCAGCCATAA CACAAGCCTGTCCAAAGGTCACTTTGGATCCAATTCCTATACATTATTGT GCTCCAGCTGGATATGCGATTCTAAAGTGTAATAATAAGACATTCAATGG GACAGGACCATGCCATAATGTCAGCACAGTACAATGTACACACGGAATCA AGCCAGTGGTATCAACTCAACTACTGTTAAATGGTAGCCTAGCAGAAGAA GAGATAATAATTAGGTCTGAAAATCTAACAAACAATGCCAAAACAATAAT AGTACATCTTAATGAATCTGTAGAAATTGTGTGTACAAGACCCAGCAATA ATACAAGAAAAAGTATAAGGATA---------GGACCAGGACAAGCATTC TATGCA---ACAGGTGGC------ATAATAGGAAACATA---AGACAAGC ACATTGTAACATTAGTAAAGAGAACTGGAATAAAACTTTACAAAAGGTAG GAAAAAAATTAGCAGAG---------CACTTCCCTAAT---------AAA ACA---------ATAAAATTTGACCAACACTCA---GGAGGGGACCTAGA AATTACAACACATAGCTTTAATTGTAGAGGAGAATTTTTCTATTGCAATA CATCAAACCTGTTTAATAGTACATATAAGCCTAAT------------GAT ACA------------------AATAGTACATATAATCCTAATGATACAAT CACACTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGGGGGTAG GACAAGCAATGTATGCCCCTCCCATTGCAGGAAACATAACATGTAAATCA AATATCACAGGACTACTATTGACACGGGATGGAGGGTCAAATGAT----- -ACCACAAACACAGAGACATTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAACTATATAAATATAAAGTGGTAGAAATTAAACCATTG GGCATAGCACCCACT---------GCGGCAAAAAGGAGA------GTGGT GGAGACGAGAGAAAAAAGAGCA---GTGGGA---ATAGGAGCTGTGTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGCACAGGCCAGACAAGTGTTGTCTGGTATAGTGCAACAGCAAAG CAATTTGCTGAGAGCCATAGAGGCGCAACAGCATCTGTTGCAACTCACGG TCTGGGGCATTAAGCAGCTCCAGACAAGAGTCTTGGCTATGGAAAGATAC CTAAAGGATCAACAGCTCCTAGGGATTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTGCCGTGTCTTGGAACTCCAGTTGGAGTAATAAGTCTCAAA CAGAT---ATTTGGGATAACATGACCTGGATGCAGTGGGATAGAGAAATT AGTAATTACACAGACACAATATACAGGTTGCTTGAAGAATCGCAAATTCA GCAGGAAAGAAATGAAAAAGACTTATTAGCATTGGACAGTTGGAAAAATC TATGGAATTGGTTTGACATAACAAATTGGCTGTGGTATATAAAAATATTC ATAATGATAGTAGGAGGCTTGATAGGCTTAAGAATAAGTTTTGCTGTGCT TTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCTTTGTCGTTTCAGA CCCTTACCCCGAACCCAAGG---GGACCCGACAGGCTCGGAAGAATCGAA GAAGAAGGTGGAGAGCAAGACAGAGACAAATCCATTCGCTTAGTGGACGG ATTCTTAGCACTTTTCTGGGACGACCTGCGGAGCCTGTGCCTTTTCAGCT ACCACCGATTGAGAGACTTCATATTGATTGCAGCGAGAGCAGCGGAACTT CTGGGACGCAGCAGTCTCAGGGGACTACAGAGGGGG---TGGGAAGCCCT T------AAGTATCTGGGAAGT---------------------CTTGTGC AGTATTGGGGTCTGGAACTAAAAAAGAGTGCTATTAGTCTGGTTGATGCC ATAGCAATAACAGTAGCTGAAGGAACAGATAGGATTATAGAATTCATACA AAGAATTTGTAGAGCTATCCGCAACATACCTAGAAGAAT----------- -------------------- ; D-NDK ATGAGAGCGAGGGAGAAAGAGAGGAATTGTCAAAACTTGTGGAAATGG-- ----------GGCATCATGCTCCTTGGGATGTTGATGACCTGTAGTGCTG CA---GAAGATTTGTGGGTCACAGTTTATTATGGGGTGCCTATATGGAAG GAAGCAACTACCACTCTATTTTGTGCATCAGATGCTAAAGCATATAAAAA AGAGGCACATAATATCTGGGCCACACATGCCTGTGTACCCACGGACCCCA ACCCACAAGAAATAGAATTGGAAAATGTGACAGAAAACTTTAACATGTGG AAAAATAACATGGTGGAACAAATGCATGAGGATATAATCAGTTTATGGGA TCAAAGCCTAAAACCATGTGTAAAATTAACTCCACTCTGTGTCACTTTAA ACTGCACTGATGAA---------TTGAGGAAC------------------ ---------------AGCAAGGGCAAT---------GGGAAGGTA---GA AGAGGAGGAAAAAAGGAAAAACTGCTCTTTCAAT------------GTAA GGGATAAGAGGGAGCAAGTATATGCACTTTTTTATAAACTTGATATAGTG CCAATAGACAATAAT---------------------AATAGGACCAATAG TACT---------AATTATAGGTTAATAAATTGTGATACCTCAACCATTA CACAGGCTTGTCCAAAGATATCCTTTGAACCAATTCCCATACATTTTTGT GCCCCAGCTGGTTTTGCAATTCTAAAGTGTAGAGATAAGAAGTTCAATGG GACAGGCCCATGCTCAAATGTCAGCACAGTACAATGTACACATGGAATTA GACCAGTGGTGTCAACTCAACTGCTGTTGAATGGCAGTCTAGCAGAAGAA GAGATCATAATTAGATCTGAAAATCTCACAAACAATGTTAAAACCATAAT AGTACAGCTTAATGCATCTATAGTAATTAATTGTACAAGGCCCTACAAAT ATACAAGGCAAAGGACATCGATA---------GGACTAAGGCAATCACTC TATACAATAACAGGAAAAAAGAAGAAAACAGGATACATA---GGACAAGC ACATTGTAAAATTAGCAGAGCAGAATGGAATAAAGCTTTACAACAGGTAG CTACAAAACTAGGAAAC---------CTTCTTAACAAA---------ACA ACA---------ATAACTTTTAAGCCATCCTCA---GGAGGGGACCCAGA AATTACATCACACATGCTTAATTGTGGAGGGGACTTCTTCTACTGTAATA CATCAAGACTGTTTAATAGTACATGG------AAT------------CAG ACTAATAGT---------ACAGGGTTCAATAATGGCACA---------GT CACACTCCCATGCAGAATAAAACAAATTGTAAACTTGTGGCAGAGAGTAG GAAAAGCAATGTATGCCCCTCCCATCGAAGGACTAATTAAATGTTCATCA AATATTACAGGGCTACTATTAACAAGAGATGGTGGTGCAAAT---AAT-- ----AGTTCTCATGAGACCATCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCAATA GGAGTAGCACCCACC---------AAGGCAAGGAGAAGA------GTGGT G---GAAAGAGAAAAAAGAGCA---ATAGGA---CTAGGAGCTGTGTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACGATGGGCGCAGCGTCAGTGACG CTGACGGTACAGGCCAGACAGTTAATGTCTGGTATAGTGCACCAGCAAAA CAATTTGCTGAGGGCTATAGAGGCGCAACAACATCTGTTGCAACTCACGG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAGGGATCAACAGCTCCTAGGAATTTGGGGTTGCTCTGGAAGGCACAT TTGCACCACTAATGTACCCTGGAACTCTAGTTGGAGTAATAGATCTCTAG ATGAG---ATTTGGCAGAACATGACCTGGATGGAGTGGGAAAGAGAAATT GACAATTACACAGGCTTAATATACAGCTTAATTGAAGAATCGCAGATCCA GCAAGAAAAGAATGAAAAAGAATTATTGGAATTGGACAAATGGGCAAGTT TGTGGAATTGGTTTAGCATAACAAAATGGCTGTGGTATATAAAATTATTC ATAATGATAGTAGGAGGCCTGATAGGTTTAAGAATAGTTTTTGCTGTGCT TTCTGTAGTAAATAGAGTTAGGCAGGGATACTCACCTCTGTCATTTCAGA CCCTCCTCCCAGTCCCGAGG---GGACCCGACAGGCCCGAAGAAATAGAA GAAGAAGGTGGAGAGCGAGGCAGAGACAGATCCATTCGATTGGTGAACGG ATTATTTGCACTTTTCTGGGACGACCTGAGGAACCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTCAATCTTAATTGCAGCGAGGATTGTGGAACTT CTGGGACGCAGG---------------------GGG---TGGGAAGCCCT C------AAATACCTGTGGAAC---------------------CTCCTGC AGTATTGGAGTCAGGAACTGAGGAATAGTGCTAGTAGCTTGCTTGATACC ATAGCAATAGCAGTAGCTGAGAGGACAGATAGGGTTATAGAAGTAGTACA AAGAGCTTGCAGAGCTATTCTTAACGTACCCAGAAGAATAAGACAGGGCT TGGAAAGGCTTTTGCTATAA ; D-Z2Z6 ATGAGAGTGAGGGGGATAGAGAGGAATTGTCAAAACTTGTGGAAATGG-- ----------GGCATCATGCTCCTTGGGATATTGATGACCTGTAGTAATG CA---GACAATCTGTGGGTCACAGTGTATTATGGGGTGCCTGTATGGAAG GAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAATCATATAAAAC AGAGGCACATAATATCTGGGCCACACATGCCTGTGTACCCACGGACCCCA ACCCACAAGAAATAGAACTGGAAAATGTGACAGAAAACTTTAACATGTGG AGAAATAACATGGTGGAACAGATGCATGAGGATATAATCAGTTTATGGGA TCAAAGCCTAAAACCATGTGTAAAATTAACCCCACTCTGTGTCACTTTAA ACTGCATAGATGAA------GTGATGGAGAATGTCACA------------ ---------------ATGAAGAATAAT---------AATGTCACA----- -GAGGAAATAAGAATGAAAAACTGCTCTTTCAATATAACTACAGTAGTAA GAGATAAGACAAAACAAGTACATGCACTTTTTTATAGACTTGATATAGTA CCCATAGACAATGAT---------------------AATAGTACCAATAG TACC---------AATTATAGATTAATAAATTGTAATACCTCAGCCATTA CACAGGCTTGTCCAAAGGTGTCCTTTGAGCCAATTCCCATACATTATTGT GCCCCAGCTGGTTTTGCAATTCTAAAATGTAGAGATAAAAGGTTCAATGG AACAGGCCCATGCACAAATGTCAGCACAGTACAATGTACACATGGAATTA GGCCAGTGGTGTCAACTCAACTGCTGTTGAATGGCAGTCTAGCAGAAGAA GAGATCATAATTAGATCTGAAAACCTCACAAACAATGCTAAAATCATAAT AGTACAGCTCAATGAGTCTGTAGCAATTAACTGTACAAGGCCCTACAGAA ATATAAGACAAAGGACATCTATA---------GGATTAGGGCAAGCGCTC TATACA---ACA---AAA------ACAAGAAGTATAATA---GGACAAGC ATATTGTAATATTAGTAAAAATGAATGGAATAAGACATTACAACAGGTAG CTATAAAATTAGGAAAC---------CTTCTTAACAAA---------ACA ACA---------ATAATTTTTAAACCATCCTCA---GGAGGGGACCCAGA AATTACAACACACAGTTTTAATTGTGGAGGGGAATTCTTCTACTGTAATA CATCAGGACTGTTTAATAGTACATGG------GATATTAGT------AAA TCAGAATGGGCTAATAGTACAGAGTCAGAT---GATAAACCA------AT CACACTCCAATGCAGAATAAAACAAATTATAAACATGTGGCAGGGAGTAG GAAAAGCAATGTATGCCCCTCCCATCGAAGGACAAATTAATTGTTCATCA AATATTACAGGGCTATTATTGACAAGAGATGGTGGTACAAAT---AAT-- ----AGTTCTAACGAGACCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAGGTAGTAAAAATTGAGCCACTA GGAGTAGCACCTACC---------AGGGCAAAGAGAAGA------GTGGT G---GAAAGAGAAAAAAGAGCA---ATAGGA---CTAGGAGCTATGTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACGATGGGCGCACGGTCATTGACG CTGACGGTACAGGCCAGACAGTTATTGTCTGGTATAGTGCAACAGCAAAA CAATTTGCTGAGGGCTATAGAGGCGCAACAGCATCTGTTGCAACTCACGG TCTGGGGCATTAAACAGCTCCAGGCAAGAATCCTGGCTGTAGAGAGATAC CTAAAGGATCAACAGCTCCTAGGAATTTGGGGTTGCTCTGGAAAACTCAT TTGCACCACTACTGTGCCCTGGAACTCTAGTTGGAGTAATAGATCTCTAA ATGAC---ATTTGGCAGAACATGACCTGGATGGAGTGGGAAAGAGAAATT GACAATTACACAGGCTTAATATATAGATTAATTGAAGAATCGCAAACCCA GCAAGAAAAGAATGAACAAGAATTATTGGAATTGGACAAGTGGGCAAGTT TGTGGAATTGGTTTAACATAACACAATGGCTGTGGTATATAAAAATATTC ATAATGATAGTAGGAGGCTTGATAGGTTTAAGAATAGTTTTTGCTGTGCT TTCTTTAGTAAATAGAGTTAGGCAGGGATATTCACCTCTGTCATTTCAGA CCCTCCTCCCAGCCCCGAGG---GGACCCGACAGGCCCGAAGGAATAGAA GAAGAAGGTGGAGAGCGAGGCAGAGACAGATCCATTCGATTGGTGAACGG ATTCTCAGCACTTATCTGGGACGATCTGAGGAACCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTAATCTTAATTGCAGCGAGGATTGTGGAGCTT CTGGGACGCAGG---------------------GGG---TGGGAAGCCCT C------AAATATCTGTGGAAT---------------------CTCCTAC AGTATTGGAGTCGGGAACTGAAGAACAGTGCTAGTAGCTTGCTTGATACC ATAGCAATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAATAGTACG AAGAGCTTGCAGAGCTGTTCTTCACATACCCACAAGAATAAGACAGGGCT TAGAAAGGCTTTTGCTTTAA ; D-ELI ATGAGAGCGAGGGGGATAGAGAGAAATTGTCAAAACTGGTGGAAATGG-- ----------GGCATCATGCTCCTTGGGATATTGATGACCTGTAGTGCTG CA---GACAATCTGTGGGTCACAGTTTATTATGGGGTGCCTGTATGGAAG GAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAATCATATGAAAC AGAGGCACATAATATCTGGGCCACACATGCCTGTGTACCCACGGACCCCA ACCCACAAGAAATAGCACTGGAAAATGTGACAGAAAACTTTAACATGTGG AAAAATAACATGGTGGAACAGATGCATGAGGATATAATCAGTTTATGGGA TCAAAGCCTAAAACCATGTGTAAAATTAACCCCACTCTGTGTCACTTTAA ACTGTAGTGATGAA------TTGAGGAACAATGGCACT------------ ---------------ATGGGGAACAAT---------GTC------ACTAC AGAGGAGAAAGGAATGAAAAACTGCTCTTTCAATGTAACCACAGTACTAA AAGATAAGAAGCAGCAAGTATATGCACTTTTTTATAGACTTGATATAGTA CCAATAGACAATGAT---------------------AGTAGTACCAATAG TACC---------AATTATAGGTTAATAAATTGTAATACCTCAGCCATTA CACAGGCTTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGT GCCCCAGCTGGTTTTGCGATTCTAAAGTGTAGAGATAAGAAGTTCAATGG AACAGGCCCATGCACAAATGTCAGCACAGTACAATGTACACATGGAATTA GGCCAGTGGTGTCAACTCAACTGCTGTTGAATGGCAGTCTAGCAGAAGAA GAGGTCATAATTAGATCCGAAAATCTCACAAACAATGCTAAAAACATAAT AGCACATCTTAATGAATCTGTAAAAATTACCTGTGCAAGGCCCTATCAAA ATACAAGACAAAGAACACCTATA---------GGACTAGGGCAATCACTC TATACT---ACA---AGA------TCAAGATCAATAATA---GGACAAGC ACATTGTAATATTAGTAGAGCACAATGGAGTAAAACTTTACAACAAGTAG CTAGAAAATTAGGAACC---------CTTCTTAACAAA---------ACA ATA---------ATAAAGTTTAAACCATCCTCA---GGAGGGGACCCAGA AATTACAACACACAGTTTTAATTGTGGAGGGGAATTCTTCTACTGTAATA CATCAGGACTGTTTAATAGTACATGG------AAT------------ATT AGTGCATGGAATAATATTACAGAGTCAAATAATAGCACAAACACAAACAT CACACTCCAATGCAGAATAAAACAAATTATAAAGATGGTG--GCAGGCAG GA-AAGCAATATATGCCCCTCCTATCGAAAGAAACATTCTATGTTCATCA AATATTACAGGGCTACTATTGACAAGAGATGGTGGTATAAAT---AAT-- ----AGTACTAACGAGACCTTTAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAGGTAGTACAAATTGAACCACTA GGAGTAGCACCCACC---------AGGGCAAAGAGAAGA------GTGGT G---GAAAGAGAAAAAAGAGCA---ATAGGA---TTAGGAGCTATGTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACGATGGGCGCACGGTCAGTGACG CTGACGGTACAGGCCAGACAATTAATGTCTGGTATAGTGCAACAGCAAAA CAATTTGCTGAGGGCTATAGAGGCGCAACAGCATCTGTTGCAACTCACGG TCTGGGGCATTAAACAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATAC CTAAAGGATCAACAGCTCCTAGGAATTTGGGGTTGCTCTGGAAAACACAT TTGCACCACTAATGTGCCCTGGAACTCTAGTTGGAGTAATAGATCTCTAA ATGAG---ATTTGGCAGAACATGACCTGGATGGAGTGGGAAAGAGAAATT GACAATTACACAGGCTTAATATATAGCTTAATTGAGGAATCGCAGACCCA GCAAGAAAAGAATGAAAAAGAATTGTTGGAATTGGACAAGTGGGCAAGTT TGTGGAATTGGTTTAGCATAACACAATGGCTGTGGTATATAAAAATATTC ATAATGATAATAGGAGGCTTGATAGGTTTAAGAATAGTTTTTGCTGTGCT TTCTTTAGTAAATAGAGTTAGGCAGGGATACTCACCTCTGTCGTTTCAGA CCCTCCTCCCAGCCCCGAGG---GGACCCGACAGGCCCGAAGGAACAGAA GAAGAAGGTGGAGAGCGAGGCAGAGACAGATCCGTGAGATTGCTGAACGG ATTCTCGGCACTTATCTGGGACGACCTGCGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTAATCTTAATTGCAGTGAGGATTGTAGAACTT CTGGGACGCAGG---------------------GGG---TGGGACATCCT C------AAATATCTGTGGAAT---------------------CTCCTAC AGTATTGGAGTCAGGAACTGAGGAACAGTGCTAGTAGCTTGTTTGATGCC ATAGCAATAGCAGTAGCTGAGGGGACAGATAGAGTTATAGAAATAATACA AAGAGCTTGCAGAGCTGTTCTTAACATACCCAGAAGAATAAGACAGGGCT TAGAAAGGTCTTTACTTTAA ; D-94UG114.1 ATGAGAGTGAGGGAGACAAAGAGGAATTATCAGCACTTGTGGAAATGG-- ----------GGCACGATGCTCCTTGGGATGCTGATGATATGTAGTGTTA CA---GGAAAGTCGTGGGTCACAGTTTATTATGGGGTGCCTGTGTGGAAA GAAGCAACCACTACTCTATTTTGTGCATCAGATGCTAAGGCATATAAAGC AGAGGCACATAACATCTGGGCTACACATGCCTGTGTACCAACAGACCCCA ACCCACAAGAAATAAAACTAGAAAATGTCACAGAAAACTTTAATATGTGG AAAAATAACATGGTGGAGCAGATGCATGAGGATATAATCAGTTTATGGGA TCAAAGTCTAAAACCATGTGTAAAGTTAACCCCACTCTGTGTCACTTTAA ACTGCACTAACTGG------------------GTC--------------- ACT------------GATACCACCAAT----------------------- ----ACCACAGGAATGGCAAACTGCTCTTTCAATATAACCACAGAAATAA GAGATAAGAAGAAGCAAGTACAGGCACTTTTTTATAAACTTGATGTGGTA AAAATAAATGATAAT------------------GATAGTGATAACACC-- -------------AGCTATAGACTAATAAATTGTAATACCTCAGCCATTA CACAGGCGTGTCCAAAGATGACCTTTGAGCCAATTCCCATACATTATTGT GCCCCAGCTGGATTTGCAATTCTAAAATGTAACGAAAAGAAGTTCAATGG AACAGGTCCATGCAAAAATGTCAGCACAGTACAGTGTACACATGGGATTA AGCCAGTAGTGTCAACTCAACTGTTGTTGAATGGCAGTCTAGCAGAAGAA GAAATAATAATTAGATCTGAAAATCTCACAAACAATGCTAAAATCATAAT AGTACAGCTTAATGAGTCTGTACCAATTAATTGCATAAGGCCCTATAACA ATACAAGACAAAGTACACGTATA---------GGACCAGGGCAAGCACTC TTTACA---ACA---AAA------GTAATAGGAGATATA---AGACAAGC ACATTGTAACATTAGTGGAGCAGGATGGAATAAAACTTTACAACAGGTAG CTGAAAAATTAGGAAAC---------CTTCTTAACCAG---------ACA ACA---------ATAATTTTTAAACCATCCTCG---GGAGGGGACCCAGA AATTACAACACACAGCTTTAATTGTGGAGGGGAATTTTTCTACTGCAATA CAACAAGACTGTTTAATAGTACATGGAAAAGGAAT------------AAT AGTGAATGGAGGAGTGATAATACACCAGAT---GAGACA---------AT CACACTCCAATGCAGAATAAAACAAATTATAAACATGTGGCAGGAAGTAG GAAAAGCAATGTATGCCCCTCCCATTGAAGGATTCATCAACTGTTCATCA AATATTACAGGACTATTGTTGACAAGAGATGGTGGTGCAATT---AAT-- -AGTAGCCAGAATGAGACCTTCAGACCTGGAGGAGGAGATATGAGAAACA ATTGGAGAAGTGAATTATACAAATATAAAGTAGTAAAACTTGAACCAATA GGTCTAGCGCCCACC---------GCGGCAAAGAGAAGA------GTGGT A---GAAAGAGAAAAAAGAGCA---ATAGGA---CTGGGAGCTCTGTTCC TTGGGTTCTTGGGAACAGCAGGAAGCACGATGGGCGCAGTGTCACTGACG CTGACGGTACAGGCCAGACAGGTATTGTCTGGTATAGTGCAACAGCAAAA CAATTTGCTGAGGGCTATAGAGGCGCAACAGCATCTGTTGCAACTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGCTAC CTAAAGGATCAACAGCTCCTAGGAATTTGGGGTTGCTCTGGAAAACACAT TTGCACCACTAATGTGCCCTGGAACTCTAGCTGGAGTAATAGATCTGTAG ATGAA---ATTTGGAATAACATGACCTGGATGGAGTGGGAAAGAGAAATT GACAATTATACAGAGTTAGTATACAGCTTACTTGAAGTATCGCAAATCCA GCAAGAGAAAAATGAACAAGAACTATTGAAATTGGACACATGGGCAAGTT TGTGGAATTGGTTTAGCATAACACAATGGCTGTGGTATATAAAAATATTC ATAATGATAGTAGGAGGCTTGATAGGTTTAAGAATAGTTTTTGCTGTGCT TTCTGTAGTAAATAGAGTTAGGCAGGGATACTCACCTCTGTCATTTCAGA CCCTCCTCCCAGCCCCGAGG---GAACCCGACAGGCCCGAAGGAATAGAA GAAGAAGGTGGAGAGCGAGACAGAGGCAGATCCATTCGATTGGTGAACGG ATTATCAGCACTTATCTGGGACGATTTGAGGAACCTGTGCCTCTTCAGTT ACCACCGCTTGAGAGACTTAATCTTAATTGCAGCGAGGATTGTGGAACTT CTGGGACGCAGG---------------------GGG---TGGGAAGCCAT C------AAATATCTGTGGAAT---------------------CTCCTGC AGTATTGGATTCAGGAACTAAAGAATAGTGCTGTTAGCCTGTTTAATACC ATAGCAATAGCAGTAGCTGAGGGGACAGATAGGGCTATAGAACTAGTGCA AAGAGCTGTTAGAGCTATTCTTAACATACCTGTACGGATAAGACAGGGCT TGGAAAGGGCTTTACTATAA ; E-CM240 ATGAGAGTGAAGGAGACACAGATGAATTGGCCAAACTTGTGGAAATGG-- ----------GGGACTTTGATCCTTGGGTTGGTGATAATTTGTAGTGCCT CA---GACAACTTGTGGGTTACAGTTTATTATGGGGTGCCTGTGTGGAGA GATGCAGATACCACCCTATTTTGTGCATCAGATGCCAAGGCACATGAGAC AGAAGTGCACAATGTCTGGGCCACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAAATACACCTGGAAAATGTAACAGAAAATTTTAACATGTGG AAAAATAACATGGTAGAGCAGATGCAGGAGGATGTAATCAGTTTATGGGA TCAAAGTCTAAAGCCATGTGTAAAGTTAACTCCTCTCTGCGTTACTTTAA ATTGTACCAATGCTAAT------TTGACCAATGGCAGTAGCAAAACC--- ---------------AATGTCTCT------------AACATAATAGGAAA TATAACAGATGAAGTAAGAAACTGTACTTTTAATATGACCACAGAACTAA CAGATAAGAAGCAGAAGGTCCATGCACTCTTTTATAAGCTTGATATAGTA CAAATTGAAGAT---------------AAGAAGACTAGTAGT-------- -------------GAGTATAGGTTAATAAATTGTAATACTTCAGTCATTA AGCAGGCTTGTCCAAAGATATCCTTTGATCCAATTCCTATACATTATTGT ACTCCAGCTGGTTATGCGATTTTAAAGTGTAATGATAAGAATTTCAATGG GACAGGGCCATGTAAAAATGTCAGCTCAGTACAATGCACACATGGAATTA AGCCAGTGGTATCAACTCAATTGCTGTTAAATGGCAGTCTAGCAGAAGAA GAGATAATAATCAGATCTGAAGATCTCACAAACAATGCCAAAACCATAAT AGTGCACCTTAATAAATCTGTAGAAATCAATTGTACCAGACCCTCCAACA ATACAAGAACAAGTATAACTATA---------GGACCAGGACGAGTATTC TATAGA---ACAGGAGAT------ATAATAGGAAATATA---AGAAAAGC ATATTGTGAGATTAATGGAACAAAATGGAATAAAGTTTTAAAACAGGTAA CTGAAAAATTAAAAGAG---------CACTTTAAT------------AAG ACA---------ATAATCTTTCAACCACCCTCA---GGAGGAGATCTAGA AATTACAATGCATCATTTTAATTGTAGAGGGGAATTTTTCTATTGCAATA CAACAAAACTGTTTAATAATACTTGC---------CTAGGA------AAT GAAACC---ATGGCGGGGTGTAAT---------GACACT---------AT CACACTTCCATGCAAGATAAAGCAAATTATAAACATGTGGCAGGGAGCAG GACAAGCAATGTATGCTCCTCCCATCAGTGGAAGAATTAATTGTGTATCA AATATTACAGGAATACTATTGACAAGAGATGGTGGTGTTAAT---AAT-- ----ACGGATAACGAGACCTTCAGACCTGGAGGAGGAAACATAAAGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTACAAATTGAACCACTA GGAATAGCACCCACC---------AGGGCAAAGAGAAGA------GTGGT G---GAGAGAGAAAAAAGGGCA---GTGGGA---ATAGGAGCTATGATCT TTGGGTTCTTAGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAG CAATTTGCTGAGGGCTATAGAGGCGCAGCAGCATCTGTTGCAACTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAAGGATCAAAAGTTCCTAGGACTTTGGGGCTGCTCTGGAAAAATCAT CTGCACCACTGCTGTGCCCTGGAACTCCACTTGGAGTAATAGATCTTTTG AAGAG---ATTTGGAACAACATGACATGGATAGAATGGGAGAGAGAAATT AGCAATTACACAAACCAAATATATGAGATACTTACAGAATCGCAGAACCA ACAGGACAGGAATGAAAAGGATTTGTTAGAATTGGATAAATGGGCAAGTC TGTGGAATTGGTTTGACATAACAAATTGGCTGTGGTATATAAAAATATTT ATAATGATAGTAGGAGGTTTAATAGGTTTAAGAATAATTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCTTTGTCTTTCCAGA CCCCTTCCCATCATCAGAAG---GAACCCGACAGACCCGAAGGAATCGAA GAAGGAGGTGGCGAGCAAGGCAGAGACAGATCAGTGCGATTAGTGAGCGG ATTCTTAGCACTTGCCTGGGACGATCTACGGAGCCTGTGCCTCTTCAGCT ACCACCGGTTGAGAGACTTAACCTTGATTGCAGCGAGGACGGTGGAACTT CTGGGACACAGCAGTCTCAAGGGACTGAGACGGGGG---TGGGAAGGCCT C------AAATATCTGGGGAAT---------------------CTTCTGT TATATTGGGGCCAGGAACTAAAAATTAGTGCTATTTCTTTGCTTGATGCT ACAGCAATAGCAGCAGCGGGGTGGACAGACAGGGTTATAGAAGTAGCACA AGGAGCTTGGAGAGCCATTCTCCACATACCTAGAAGAATCAGACAGGGCT TAGAAAGGACTTTGCTATAA ; E-TN235 ATGAGAGTAAAGGAGACACAGATGAATTGGCCAAACTTGTAAAAATGG-- ----------GGGACTTTAATCCTTGGGTTGGTGATAATTTGTAGTGCCT CA---AACAACTTGTGGGTTACAGTTTATTATGGGGTTCCTGTGTGGAGA GATGCAGATACCACCCTATTTTGTGCATCAAATGCCAAAGCACATGAGAC AGAAGTGCACAATGTCTGGGCCACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAAATACACCTGGAAAATGTAACAGAAAATTTTAACATGTGG AAAAATAACATGGTAGAGCAGATGCAGGAGGATGTAATCAGTTTATGGGA TCAAAGTCTAAAGCCATGTGTAAAGTTAACTCCTCTCTGCGTTACTTTAC ATTGTACCAATGCTAAGTTGACCACTGCTAAT------AATCACAAT--- ---------------AACATAACCAGTGTCTCTAACACAATAGGAAATAT AACA---GATGAAGTAAGAAACTGTTCTTTTAATATGACCACAGAACTAA GAGATAAGAAGCAGAAGGTCCATGCACTTTTTTATAAGCTTGATATAGTA CCAATTGAAGAT---------------AATAAGACTAGTAGTGAG----- ----------------TATAGGTTAATAAATTGTAATACTTCAGTCATTA AGCAGGCTTGTCCAAAGATATCCTTTGATCCAATTCCTATACATTATTGT ACTCCAGCTGGTTATGCGATTTTAAAGTGTAATGATAAAAATTTCAATGG GACAGGGCCATGTAAAAATGTCAGCTCAGTACAATGCACACATGGAATTA AGCCAGTGGTATCAACTCAATTGCTGTTAAATGGCAGTCTAGCAGAAGAA GAGATAATAATCAGATCTGAAAATCTCACAAACAATGCCAAAACCATAAT AGTGCACCTTAATAAATCTGTAGAAATCAATTGTACCAGACCCTCCAACA ATACAAGAACAAGTATACCTATA---------GGTCCAGGACAAGCATTC TATAGA---ACAGGAGAC------ATAATAGGAGATATA---AGAAAAGC ATATTGTGAGATTAATGGAACAAAATGGAATGAAGTTTTAACACAGGTAA CTGAAAAATTAAAAGAG---------CACTTTAATAAT---------AAG ACA---------ATAATCTTTCAACCACCCTCA---GGAGGAGATCTAGA AATTACAATGCATCATTTTAATTGTAAAGGGGAATTTTTCTATTGCAATA CAACACGACTGTTTAATAATACTTGCATAGAAAAT------------GGA ACCATGGGGGGGTGTAATGGCACT------------------------AT CATACTTCCATGCAAGATAAAGCAAATTATAAACATGTGGCAAGGAGCAG GACAAGCAATGTATGCTCCTCCCATCAGTGGAAGAATTAATTGTGTATCA AATATTACAGGAATACTATTGACAAGAAATGGTGGTGCTATTAAT----- ----ACAACTAACGAGACCTTCAGACCTGGAGGAGGAAATATAAAGGACA ATTGAAGAAGTAAATTATATAAATATAAAGTAGTACAAATTGAACCACTA GGAATAGCACCCACC---------AGGGCAAAGAGAAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTGGAA---ATAGGAGCTATGATCT TTGGGTTCTTAGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAG CAATTTGCTGAGGGCTATAGAGGCGCAGCAGCATCTGTTGCAACTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAAGGATCAAAAGTTCCTAGGACTTTGGGGCTGCTCTGGAAAAATCAT CTGCACCACTGCTGTGCCCTGAAACTCCACTTGGAGTAATAGATCTTATG AAGAG---ATTTGGAACAACATGACATGGATAGAATGGGAGAGAGAAATT AGCAATTACACAAACCAAATATATGAGATACTTACAGAATCGCAGAACCA GCAGGACAGAAATGAAAAAGATTTGTTAGAATTGGATAAATGGGCAAGTC TGTGGAATTGGTTTGACATAACAAAGTGGCTGTGGTATATAAAAATATTT ATAATGATAATAGGAGGTTTAATAGGTTTAAGGATAATTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCTTTGTCTTTCCAGA CCCCTTTCCATCATCAGAGG---GAACCCGACAGATCCGAAAGAATCGAA GAAGGAGGTGGCGAGCAAGGCAGAGACAGATCCGTGCGATTAGTGAGCGG ATTCTTAGCTCTTGCGTGGGACGATCTACGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTCATCTTGATTGCAGCGAGGACTGTGAAACTT CTGGGACGCAGCAGTCTCAAGGGACTGAGACGGGGG---TGGGAAGGTCT C------AAATATCTGGGGAAT---------------------CTTCTGT TATATTGGGGTCAGGAACAAAAAATTAGCGCTATTTCTTTGCTTGATGCT ACAGCAATAATAGTAGCGGGGTGGACAGATAGGGTTATAGAAGTAGCACA AGGAGCTTGGAGAGCCATTCTCCACATACCTAGGAGAAT----------- -------------------- ; E-90CR402.1 ATGAGAGTGAAGGGGACACGGAGGAATTGGCCAAACTTGTGGAAATGG-- ----------GGGACTTTGATCCTTGGGTTGGTGATAATTTGTAGTGCCT CA---GACAACTTGTGGGTTACAGTTTATTATGGGGTTCCTGTGTGGAGA GATGCAGATACCATCCTATTTTGTGCATCAGATGCCAAAGCACATGTGAC AGAAGTGCACAATGTTTGGGCTACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAAATATACCTGGAAAATGTAACAGAAAATTTTGACATGTGG AAAAATAACATGGTAGAGCAGATGCAGGAGGATGTAATCAGTTTATGGGA TCAAAGTCTACAGCCATGTGTAAAGTTAACTCCTCTCTGTGTTACTTTAC ATTGTACCAAGGCTAGTTTTACT------AATGCCACCAGT--------- ------------------------------------GACAGA---ATAAA AATGGAAGATGCAGTAAGAAACTGTTCTTTTAATATGACCACAGAACTAC AAGATAAAAAGCAGGAGGTCCATGCACTTTTTTATACGTCTGATGTAGTA CAAATTAGTAGTAGTGTACAAAATAATAATAACAGTAATACTAGTGGACA AAATAATAGTCATAAGTTTAGATTAATACATTGTAATACTTCAGTCATTA AGCAGGCTTGTCCAAAGGTATCCTTTGATCCAATTCCCATACATTATTGT GCTCCAGCTGGTTATGCGATTCTAAAGTGTAATGATAAGAATTTTAATGG AACAGGGCCATGCAAAAATGTCAGCTCAGTACAATGCACACATGGAATTA AGCCAGTGGTATCAACTCAATTGCTGTTAAATGGCAGTCTAGCAGAAGAA GAGATAATAATCAGATCTGAAGATCTCACAGACAATGCCAAAACCATAAT AGTGCACCTTAATAAATCTATAGAAATCAATTGTACCAGACCCTTCAAGA AAGTAAGAATAAGTGCAAGGATA---------GGACCAGGACGAGTATTC CATACA---ACAGGAAAC------ATAAATGGTGATATA---AGAAAAGC ATATTGTGAAATTAATAAAACAAAATGGAAAGAAACTTTAAAACAGGTAA CAAGAAAATTAAGAGAG---------CACCTTAATGGG------ACAATG ACA---------ATAAGCTTTCGACCATCCTCA---GGAGGAGATCCAGA AATCACAATGCATCATTTTAATTGTAGAGGGGAATTTTTCTATTGCAATA CAACAGCACTGTTTAATAGTACTTGG------ATAAATGGA------ACC ATGCAGGAGGTTAATGGCACAAACTCA------GGCAAT---------AT CACACTTCCATGCAGGATAAAGCAAATTGTAAACATGTGGCAGGAAGTAG GACGAGCAATGTATGCTCCTCCCATCAGTGAAGTAATTAATTGTGTATCA AATATTACAGGAATACTATTGACAAGAGATGGGGGTATTAATCAAAATCA GACTAACAAAAATGAGACCTTCAGACCTGGAGGAGGAAATATAAAGGACA ATTGGAGAAGTGAATTATACAAATATAAAGTAGTACAAATTGAACCACTA GGAATAGCACCCACC---------AAGGCAAGGAGAAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTGGGA---ATAGGAGCTATGATCT TTGGGTTCTTAGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAG CAATTTGCTGAGGGCTATAGAGGCGCAGCAGCATCTGTTGCAACTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAAAGATCAAAAGTTCCTAGGACTTTGGGGCTGCTCTGGAAAAATCAT CTGCACCACTTCTGTGCCTTGGAACTCCAGTTGGAGTAATAAATCTTATG AAGCT---ATTTGGAACAACATGACATGGATAGAATGGGATAGAGAAATT AACGAATACACAAACCAAATATATGAGCTACTTACAGAATCGCAGGACCA GCAGGAAAGGAATGAAAAGGATTTGTTAGCATTGGACAAGTGGGCAAGTC TGTGGAATTGGTTTGACATAACAAGGTGGCTGTGGTATATAAAAATATTT ATAATAATAGTAGGAGGTTTAATAGGTTTAAGAATAGTTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCTTTGTCGTTCCAGA CCCTTACCCACCAGCAGAGG---GAACCCGACAGGCCCGAAAGAATCGAA GAAGAAAGTGGAGAGCAAGGCAGAGACAGATCCATAAGATTGGTGAGCGG ATTCTTAGCACTTGCCTGGGACGATCTCCGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTCATCTTGATTGCAGCGAGGACTGTGGAACTT CTGGGACACAGCAGTCTACAGGGACTGAGACGGAGG---TGGGAAGGCCT C------AAATATCTGGGGAAT---------------------CTTCTGT CATATTGGGTTCAGGAACTAAGAATTAGTGCTATTACTTTGCTTGATGCT ACAGCAATAACAGTAGCGGGGTGGACAGATAGGGTTATAGAAATAGTACA AAGAGCTTGGAGAGCTATCCTCCATATACCTAGAAGAATCAGACAGGGCT TGGAAAGGGCTTTGCTATAA ; E-93TH253.3 ATGAGAGTGAAGGAGACACAGATAAATTGGCCAAACTTGTGGAAATGG-- ----------GGGACTTTGATCCTTGGGTTGGTGATAATGTGTAGTGCCT CA---AACAACTTGTGGGTTACAGTTTACTATGGGGTTCCTGTGTGGAGA GATGCAGATACCACCCTATTTTGTGCATCAGATGCCAAAGCACATGAGAC AGAAGTGCACAATGTCTGGGCCACACATGCCTGTATACCCACAGACCCCA ACCCACAAGAAATGCACCTGGAAAATGTAACAGAAAATTTTAACATGTGG AAAAATAACATGGTAGAGCAGATGCAGGAGGATGTAATCAGTTTATGGGA TCAAAGTCTAAAGCCATGTGTAAAGTTAACTCCTCTCTGCGTTACTTTAA ATTGTACCAATGCTAATTGG---ACC---AATGCTAATGTGACCAATGTC ---------AATAACAAT---------GTCACTAACATAGTAGGAAATAT AACA---GAGGAAGTAAGAAACTGCTCTTTTAATATGACCACAGAACTAA TAGATAAGAAGCAGAAGGTCTATGCACTTTTTTATAAGCTTGATATAAGA CAAATGAAT---------------------AGTAATAGTAGT-------- -------------GAGTATAGGTTAATAAATTGTAATACTTCAGTCATTA AGCAGGCTTGTCCAAAGGTATCCTTTGACCCAATTCCTATACATTATTGT ACTCCAGCTGGTTATGCGATTATAAAGTGTAATGATAAGAATTTCAATGG GACAGGGCCATGTAAAAATGTCAGCTCAGTACAATGCACACATGGAATTA AGCCAGTAGTATCAACTCAATTGCTGTTAAATGGCAGTCTAGCAGAAGAA AAGATAATAATCAGATCTGAAAATCTCACAAACAATGCCAAAACCATAAT AGTGCACCTTCATGAATCTGTAGAAATCAATTGTACCAGACCCTTCTACA ATAAAAGAACAAGGACATCTATA---------GGACAAGGACGAGTACTC TATAGA---ACAGGAGAC------ATAACAGGAAATATA---GGAAAACC ATATTGTGAGATTAATGGAACAAAATGGAATAAAGTTTTAAATCAGGTAA CTGAAAAATTAAAAGAG---------CACTTTAATAAT---------AGG AAC---------ATAAGCTTTCAGCCACCATCA---GGAGGAGATCTAGA AATTACAATGCATCATTTTATTTGTAGAGGGGAATTTTTCTATTGCAATA CAACACGACTGTTTAATAATACTTGCATAGGAAATAAAACC---ATGAAG GAGTGT---------------------------------AATGACACTAT CATACTTCCATGCAAGATAAAGCAAATTATAAACATGTGGCAGGGAGTAG GACAAGCAATGTATAATCCTCCCATCAGTGGAAACATTAATTGTGTATCA AATATTACAGGAATACTATTGACAAGAGATGGTGGTGGTGGTAAT---GG TACGAATAATGAGGAGACCTTCAGACCTGGAGGAGGGAACATGAAGGACA ATTGGAGAAATGAATTATATAAATATAAAGTAGTAGAAATTGAACCACTA GGAATAGCACCCACC---------AAGGCAAAGAGAAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTGGGA---ATAGGAGCTATGATCT TTGGGTTCTTAGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAG CAATTTGCTGAGGGCTATAGAGGCGCAGCAGCATCTGTTGCAACTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAAAGATCAAAAGTTCCTAGGACTTTGGGGCTGCTCTGGAAAAATCAT CTGCACCACTGCTGTGCCCTGAAACTCCACTTGGAGTAATAGATCTTATG AAGAG---ATTTGGGACAACATGACATGGATAGAATGGGAGAGAGAAATT AGCAATTACACAAACCAAATATATGAGATACTTACAGAATCGCAGAACCA GCAGGAAAGAAATGAAAAGGACTTGTTAGAATTGGATAAATGGGCAAGTC TGTGGAATTGGTTTGGCATAACAAAATGGCTGTGGTATATAAAAATATTT ATAATGATAGTAGGAGGTTTAATAGGTTTAAGAATAATTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCTTTGTCTTTCCAGA CCCCTACCCATCATCAGAGGGGGGAACCCGACAGACCCGAAAGAATCGAA GAAGGAGGTGGCGAGCAAGGCAGAGACAGATCCGTGCGATTAGTGAGCGG ATTCTTAGCACTTGCCTGGGACGATCTACGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTTCATCTTGATTGCAGCGAGGACTGTGGAACTT CTGGGACACAGCAGTCTCAAGGGACTGAGACGGGGG---TGGGAAGGCCT C------AAATATCTGGGGAAT---------------------CTTCTGT TATATTGGGGCCAGGAACTAAAAATTAGTGCTATTTCTTTGTTTGATGCT TTAGCAGTAGTGGTAGCGGGGTGGACAGATAGGGTTATAGAAGTAGCACA AGGAGCTTGGAGAGCCATTCTCCACATACCTAGAAGAATCAGACAGGGCT TAGAAAGGGCTTTGCTATAA ; F-93BR020.1 ATGAGAGTGAGGGGGATGCAGAGGAATTGGCAGCACTTGGGGAAGTGG-- ----------GGCCTTTTATTCCTGGGGACATTAATAATCTGTAATGCTG CA---GAAAACTTATGGGTTACAGTCTATTATGGGGTACCTGTGTGGAAA GAAGCAACCACTACTCTATTCTGTGCATCAGATGCTAAATCATATGAAAA AGAGGCACATAATGTCTGGGCTACACATGCTTGTGTACCCACAGATCCCA ATCCACAAGAAGTAGTTCTGGAAAATGTAACAGAAAGGTTTAATATGTGG GAAAATAACATGGTAGAACAAATGCATACAGATATAATCAGTTTATGGGA TCAAAGCCTAAAGCCATGTGTGAAGTTAACCCCACTCTGTGTTACTTTAG ATTGTAGAAACATTGCCACCAATGGCACCAATGACACTATTGCCATC--- ---------------AATGAC---ACT---------------CTGAAGGA AGATCCAGAGGCAATACAAAACTGTTCTTTCAATACAACCACAGAAATAA GAGATAAGCAGCTGAAAGTACATGCACTTTTTTATAAACTTGATATAGTA CAAATCAACAAG---------------GATGACAAT-------------- -AGAACA---------TACAGACTAATAAATTGTGATGCCTCAACCATTA CACAGGCTTGTCCAAAGGTATCTTGGGATCCAATTCCCATACATTATTGT GCTCCAGCTGGTTATGCGATTCTAAAGTGTAATGAGAAAAATTTCACAGG GACAGGGTCATGCAAGAATGTCAGTACAGTACAATGTACACATGGAATTA AACCAGTGGTATCCACTCAATTGTTGTTAAATGGCAGCCTAGCAGAAGGA GAGATAGTAATCAGATCTCAAAATATCTCAGATAATGCAAAAACCATAAT AGTGCACCTTAATGAATCTGTACAGATTAATTGTACAAGACCCAACAACA ATACAAGAAAAAGAATATCTTTA---------GGACCAGGACGAGTATTT TATACA---ACAGGAGAA------ATAATAGGAGACATC---AGAAAGGC ACATTGTAACGTTAGTGGAACACAATGGAGGAACACGTTAGCAAAGGTAA AGGCAAAGTTAGGGTCT---------TATTTCCCTAAT---------GCA ACA---------ATAAAATTTAACTCATCCTCA---GGAGGGGACCTAGA AATTACAAGGCATAATTTTAATTGTATGGGAGAATTTTTCTACTGTAATA CAGATGAACTGTTTAAT------------GACACA--------------- ---AAATTC---AATGACACAGGATTCAAT---GGCACT---------AT CACTCTCCCATGTCGAATAAAACAAATTGTAAACATGTGGCAGGAAGTGG GACGAGCAATGTATGCCAATCCCATTGCAGGAAACATTACCTGTAACTCA AATATTACAGGTCTGCTATTGACAAGAGATGGTGGTCTGAAT-------- ----AGTACTAATGAGACCTTCAGACCTGGGGGAGGAAATATGAAAGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTAGAAATTGAACCACTA GGAGTAGCACCCACC---------AAGGCAAAAAGACAA------GTGGT G---AAGAGAGAAAGAAGAGCA---GTGGGA---CTAGGAGCTCTGTTCC TTGGGTTCTTGGGAGCAGCTGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGGAATAGTGCAACAGCAGAG CAATCTGCTGAGGGCTATTGAAGCGCAACAGCATCTGTTGCAGCTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTAAAGGATCAACAGCTCCTAGGGCTTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTAATGTGCCCTGGAACTCTAGTTGGAGTAATAAATCTCTTG AGGAG---ATTTGGGGGAACATGACCTGGATGGAGTGGGAAAAAGAGGTT AGCAATTACTCAAAAGAAATATACAGGTTAATTGAAGACTCGCAGAACCA GCAGGAAAAGAATGAACAAGAATTATTAGCATTGGACAAATGGGCAAGTC TGTGGAATTGGTTTGACATAACACAGTGGCTGTGGTATATAAAAATATTC ATAATGATAGTAGGAGGCTTGATAGGCTTAAGAATAGTTTTTACTGTGCT TTCTATAGTAAATAGAGTTAGGAAGGGATACTCACCTTTGTCATTTCAGA CCCATATCCCAAGCCCGAGG---GAACCCGACAGGCCCGAAGGAATCGAA GAAGGAGGTGGAGAGCAAGGCAAAGACAGATCCGTGAGATTAGTGACCGG ATTCTTAGCTCTTGCCTGGGACGACCTGCGGAACCTGTGCCTCTTCAGCT ACCGCCACTTGAGAGACTTCATATTAATTGCAGCGAGGATTGTGGACAGG GGGCTGAAGAGG---------------------GGG---TGGGAAGCTCT C------AAATATCTGGGGAAT---------------------CTCACAC AGTATTGGGGTCAGGAACTAAAGAATAGTGCTATTAGCTTGCTTAATGCC ACAGCAATAGCAGTAGCTGAGTGGACAGATAGAGTTATAGAAGCTTTGCA AAGAGCTGGTAGAGCTATTCTCAACATACCTAGAAGAATAAGACAGGGCT TGGAAAGGGCTTTGCTATAA ; F-BZ163 ATGAGAGTGAGGGGGATGCAGAGGAACTGGCAGCACTTGGGGAAATGG-- ----------GGCCTTTTATTCCTGGGGATATTGTTAATCTGTAATGCT- -----GAAAACTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAA GATGCAACCACTACTCTATTCTGTGCATCAGATGCTAAATCATATGAGAG AGAGGTACATAATGTCTGGGCTACACATGCCTGTGTACCCACAGATCCCA ATCCACAAGAAGTAGTTCTGGAAAATGTAACAGAAAATTTTGATATGTGG AAAAATAGCATGGTAGAACAAATGCATACAGATATAATCAGTTTATGGGA TCAAAGCCTAAAGCCATGTGTGAAGTTAACCCCACTCTGTGTTACTTTAA ATTGTACTAATGCCATT------------AATGCCACTGCCATTCAAGAC GGG------------------------------------GACCTGAAGGA AGGACCAGGGGCAATACAAAACTGTTCTTTCAATGTGACCATGGAAGTA- GAGATAAGCAGCAGAAAGTACATGCACTGTTT-ATAGACTTGATATAGTA CCAATTAGCAATGGAAGA---------------AATGGCAGTGGAGAC-- -------------TACTACAGGCTAATAAATTGCAATACCTCAACCATTA CACAGGCTTGTCCAAAAGTATCTTGGGGTCCAATTCCCATACATTATTGT GCTCCAGCTGGTTATGCGATTTTAAAGTGTAATGATAAAAAGTTCAATGG GACAGGGCCATGCAAGAATGTC-GCACAGTACAGTGTACACATGGAATTA AACCAGTGGTATCAACTCAATTGTTGTTAAATGGCAGCCTAGCAGAAGAA GATATAATAATCAGATCTCAAAATATCTCAGATAATGCAAAAACCATAAT AGTACACTTTAATGAATCTGTACAGATTAATTGTACAAGACCCAACAACA ATACAAGAAAAGGTATACATATA---------GGACCAGGACGAGCATTT TATGCA---ACAGGAGAC------ATAATAGGAGACATC---AGAAAGGC CCATTGTAATGTTAGTGGAACACAATGGAATAAAACATTAGAACAAGTAA GGGCAAAGTTAAAGTCT---------CATTTTCCTAAT---------GCA ACA---------ATAAAATTTAATTCATCCTCA---GGAGGGGACCTAGA AATTACAATGCATAGTTTTAATTGTAGAGGAGAATTTTTCTACTGCAATA CATCAGGACTGTTTAACGACACAGGATCC---AAT------------GGC ACT---------------------------------------------AT CACTCTCCTATGTCGAATAAAACAAATGGTAAACATGTGGCAGGAAGTGG GACGAGCAATGTATGCCGCTCCCATCTCAGAAAACATTACCTGTAACTCG AATATTACAGGTCTACTATTGACAAGAGATGGTGGTCAGAATAAT----- ----AATCAGACTGAGACCTTCAGACCTGGGGGTGGTGATATGAAAGACT ATTGGAGAAGTGTATTATATAAGTATAAAGTAGTAGAAATTGAACCACTA GGAGTAGCACCCACC---------AGGGCAAAAAGACAA------GTGGT G---AGGAGAGAAAAAAGAGCA---GTGGGA---ATGGGAGCTTTGTTCC TTGGGTTCTTGAGCGCGGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGGAATAGTGCAACAGCAGAG TAATCTGCTGAGGGCTATTGAAGCGCAACAGCATCTGTTGCAGCTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCCGTGGAAAGATAC CTACAGGATCAACAGCTCCTAGGACTTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTAATGTGCCCTGGAACTCTAGTTGGAGTAATAAATCTCAGG AGGAG---ATTTGGGAGAACATGACCTGGATGGAATGGCAAAAAGAGATT AGCAATTACTCAAATGAAGTATACAGGTTAATTGAAAAATCACAGAACCA GCAGGAAAAGAATGAACAAGGATTATTGGCATTGGACAAATGGGCAAGTC TGTGGAATTGGTTTAGCATATCAAACTGGCTGTGGTATATAAAAATATTC ATAATGATAGTAGGAGGCTTGATAGGCTTAAGAATAGTTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGAAGGCATACTCACCTTTGTCATTTCAGA CCCATATCCCAAGCCCGAGG---GAACCCGACAGGCCCGAAGAAATCGAA GAAGGAGGTGGAGAGCAAGGCAGAGACAGATCCGTGAGATTAGTAGACGG ATTCTTAGCTCTTGTCTGGGACGACCTGAGGAACCTGTGCCTCTTCAGCT ACCACCACCTGAGAGACTTACTATTAATAACAGCGAGAATTGTGAAC--- ------------------AGGGGGCTGAGGAGGGGG---TGGGAAGCCCT C------AAACTTCTGGGGAAT---------------------CTCACGC TGTATTGGGGTCAGGAACTAAAGAATAGTGCTATTGGCTTGTTTAACACC ACAGCAATAGTAGTAGCTGAGGGAACAGATAGAATTATAGCAGCTTTGCA AAGAATTGGTAGAGCTATTTTGAACATACCTACAAGAAT----------- -------------------- ; F-BZ126 ATGAGAGTGAGGGGGATGCAGAGGAATTGGCAACACTTGGGGAAATGG-- ----------GGCCTTTTATTCCTGGGGATATTGATAATCTGTAATGCT- -----GAAAACTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAA GAAGCAACCACTACTCTATTCTGTGCATCAGATGCTAAATCATATGAAAA AGAGGTACATAATGTCTGGGCTACACATGCCTGTGTACCCACAGATCCCA ATCCACAAGAAGTAGTTCTGGAAAATGTAACAGAAAATTTTGATATGTGG AAAAATAACATGGTAGAACAAATGCATACAGATATAATCAGTTTATGGGA TCAAAGCCTAAAGCCATGTGTGAAGTTAACCCCACTCTGTGTTACTTTAC ATTGTACTAGTGCCACTCCT---------AATGCCACTGCCACTCAAAAC GGA---------------------------------ACAACCCTGAAGGA AGAACCAGGGGCAATACAAAACTGTTCTTTCAATATGTCCACAGAAGTA- GAAATAAGCAGCAGAAAGTACATGCACTTTTTTATAAACTTGATATAGTA CCAATTAGCAAT------------------------AGCAGTAATAACAG TAGA---------GAATACAGACTAATACATTGCGATACCTCAACCATTA CACAGGCTTGTCCAAAGGTATCTTGGGATCCAATTCCCATACATTATTGT GCTCCAGCTGGTTATGCGATTCTAAAATGTAATGATAAAAAGTTCAATGG GACGGGACCATGCAAGAATGTCAGCACAGTACAATGTACACATGGAATTA AACCAGTGGTATCAACTCAATTGTTGTTAAATGGCAGCCTAGCAGAAGAA GATATAATAATCAGATCCCAAAATATCTCAGATAATGCAAAAACCATAAT AGTACACTTTAATGAATCTGTACAGATTAATTGTACAAGACCCAACAACT ATACAAGAAAAAGTATATATTTT---------GGACCAGGACGAGCATTT CATACA---GCAGGAAAA------ATAATAGGAGACATC---AGAAAGGC CCATTGTAACGTTAGTGGAACACAATGGAATAAAACATTAGAACGGGTAA GGGCAAAGTTAAAGTCT---------CATTTCCCTAAT---------ACA ACA---------ATAAAATTTAACTCATCCTCA---GGAGGGGACCTAGA AATTACAATGCATAGTTTTAATTGTAGAGGAGAATTTTTCTACTGCAATA CATCAGGACTGTTTAATGACACAGGATCC---AAT------------GGC ACT---------------------------------------------AT CACTCTCCTATGTCGCATAAGACAAATTGTAAACATGTGGCAGGAAGTAG GACGAGCAATGTATGCCGCTCCCATTGAAGGAAACATTACCTGTAACTCA AATATTACAGGTCTACTATTGACAAGAGATGGTGGTCAGAATAGT----- ----AATCAGACTGAGACCTTCAGACCTGGGGGAGGAAATATGAAAGACA ATTGGAGAAGTGAATTATATAAGTATAAAGTAGTAGAAATTGAACCACTA GGAGTAGCACCCACC---------AGGGCAAAAAGACAA------GTGGT A---AAGAGAGAAAAAAGAGCAGTAGTGGGA---ATAGGAGCTTTGTTCC TTGGGTTCTTGAGCGCGGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGACAATTATTGTCTGAAATAGTGCAACAGCAGAA CAATCTGCTGAGGGCTATTGAAGCGCAACAGCATCTGTTGCAGCTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATAC CTACAGGATCAACAGCTCCTAGGACTTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTAATGTGCCCTGGAACTCTAGTTGGAGTAATAAATCTCAGG AGGAG---ATTTGGGAGAACATGACCTGGATGGAGTGGGAAAAGGAGATT AGCAATTACTCATACGAGATATACAGGTTAATTGAACAATCACAGAACCA GCAGGAAAAGAATGAACAAGAATTATTGGCATTGGACAAATGGGCAAGTC TGTGGAATTGGTTTGACATGTCAAATTGGCTGTGGTATATAAAAATATTC ATAATGATAGTAGGAGGCTTGATAGGCTTAAGAATAGTTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGAAGGGATACTCACCTTTGTCATTACAGA CCCATATCCCAAGCCCGAGG---GAACCCGACAGGCCCGAAGGAATCGAA GAAGGAGGTGGAGAGCAAGGCAACGAGAGATCCGTGCGCTTAGTGAACGG ATTCTTAGCTCTTGTCTGGGACGACCTGAGGAACCTGTGCCTCTTCAGCT ACCGCCACTTGAGAGACTTAATATTAATAGCAGCGAGGATTGTGAAC--- ------------------AGGGGGCTAAGGAGGGGG---TGGGAAGCCCT C------AAACTTCTGGGGAAT---------------------CTCACGC TGTATTGGGGTCAGGAACTAAAGAATAGTGCTATTAGCTTGCTTAACACC ACAGCAATAGTAGTAACTGAGGGAACAGATAGAATTATAGCAGCTTTGCA AAGAATTGGTAGAGCTATTCTTAACATACCTACAAGAAT----------- -------------------- ; RJI03 ************************************************** ************************************************** ************************************************** ************************************************** ************************************************** ************************************************** ************************************************** *******CTAAAGCCATGTGTGAAGTTAACCCCACTCTGTGTTACTTTAA ATTGTTCTGATGCCACCGTC---ACTCCAAGCAGAACCCTGGAAGAGCCA GGGGC--------------------------------------------- ------------AATACAAAACTGTTCTTTCAAGATGGCCACAAGAAGTA AAGATAAGCAGCAGAAAGTACATGCACTTTTTTATAGCCTTGATATAGTA CCAATTAGCAGTAACAGTGGAGAA-------------------------- ----------------TACAGGCTAATACATTGTAATACCTCAACCATTA CACAGGCTTGTCCAAAGGTATCTTGGGATCCAATTCCCATACATTATTGT GCTCCAGCTGGTTATGCGATTCTAAAGTGTAATGATAAAAAGTTCAATGG GACAGGGCCATGCACGAATGTCAGCACAGTACAATGTACACATGGAATTA AACCAGTGGTATCAACTCAATTGTTGTTAAATGGCAGCCTAGCAGAAGAG GATATAATAATCAGCTTTCAAAATATCTCAGATAATGCAAAAACCATAAT AGTACACTTTAATGAATCTGTACAGATTGATTGTACAAGACCCAACAACA ATATAAGAAAAAGTATACCTTTA---------GGACCAGGACGAGCATTT TATGCA---ACAGGAGAA------ATAATAGGAGACATC---AGAAAGGC CCATTGTAAAGTTCATGGAACTCAATGGAATAAAATGTTAGAACAGGTAA AGGCAACGTTACAGTCT---------CATTTCTCTAAT---------GCA ACA---------ATAAAATTTACCTCATCCTCA---GGAGGGGACCTAGA AATTACAATGCATAGTTTTAATTGTAGAGGAGAATTTTTCTACTGCAATA CATCAGAACTGTTTAATGACACAGTATCC---AAT------------GAC ACT---------------------------------------------AT CACTCTTCCATGTCGAATAAAACAAATTGTAAACATGTGGCAGGAAGTAG GACGAGCAATGTATGCCGCTCCCATTGCAGGAAACATTACCTGTAGCTCA AATATTACAGGTCTACTATTGACAAGAGATGGTGGTTATAATGATAATGC TACTCAGACGACTGAGACCTTCAGACCTGGGGGAGGAAATATGAAAGACA ATTGGAGAAGTGAATTATATAAGTATAAAGTGGTAGAAATTGAACCACTA GGAATAGCACCCACC---------AAGGCAAAAAGACAA------GTGGT G---AAGAGAGAAAAAAGAGCA---GTCGGA---ATAGGGGCTTTGTTCC TTGGGT-CTTGGGAGCAGCAGGAAGCA ; G-92NG003.1(g3) ATGAGAGTGAAGGGGACACAGAGGAATTGGCAACACTTGTGGACATGG-- ----------TGGACTTTGATCCTTGGGTTGGTGATAATTTGTAGTGCCT CA---AATAACTTGTGGGTCACAGTCTATTATGGGGTACCAGTGTGGGAA GACGCAGATACCCCTCTATTTTGTGCATCTGATGCTAAAGCATATAGTAC TGAAAGACATAATGTCTGGGCCACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAGATAACTCTGGAAAATGTAACAGAAACTTTTAACATGTGG AAAAATAACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGA TGAAAGCCTAAAGCCATGTGTAAAGCTAACCCCTCTCTGTGTTACCTTAA ACTGTACTAATGTCAATTGTAAC---AGTAATGTGACCAGCACTGGGAAC ---------------AGTGCTGGGACCAACGCTACGTGTAAC---ATAGA AGAAGCAAACAACTTAAAAAACTGCTCTTTCAATATAACCACAGAAATAA GAGATAAGAAAAAGACAGAATATGCGCTTTTCTATAGACTTGATGTGGTA CCAATCGATGGT------------AATAATAATGTCTCAAAT-------- -------------AACTATAGGCTAATAAATTGTAATGTCTCAACCATTA AACAAGCTTGTCCAAAGGTGTCTTTTGACCCACTTCCCATACATTATTGT GCTCCAGCTGGGTTTGCGATTTTAAAGTGTAGGGGTAAGAATTTCACTGG AACAGGACAATGTAAAAATGTCAGTTCAGTACAATGTACACATGGAATTA AACCAGTGGTATCAACTCAATTACTACTAAATGGTAGTCTAGCAGAAGGA GAAATAGTAATTAGATCTGAAAACCTCACAGACAATGCCAAAGTCATAAT AGTACAGCTTAATAAAACTATAGGAATTAATTGTACCAGACCCAACAACA ATACAAGAAAAAGTATAAGAATC---------GGACCTGGACAAGCGTTC TATGCA---ACAGGTGAA---------ATA------ATA---GGACAAGA A------------------------TGGCAGGAGATGTTACAGAAGGTAC AGGCACAACTAGAACAG---------GTCTTTAAC------------AAA AGT---------ATAACCTTTAACTCATCCGCA---GGAGGGGACCTAGA AATTACAACACATAGTTTTAATTGTAGAGGAGAATTTTTCTATTGTAATA CATCAGGATTGTTTAAT------------GAATCA--------------- ---GGAGGG---AATGAT------ACCACT------------------AT CACACTCCCATGTAAGATAAAACAAATTGTGAGAATGTGGCAGAGAGTGG GACAAGCAATGTATGCCCCTCCCATCGCAGGAGATATTACATGTAGATCA AACATTACAGGGCTATTATTAACAAGAGATGGTGGGGTTAAT---AAT-- ----ACTGGAAATGAGACCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAGTATAAAATAGTAAAAATTAAACCACTA GGAATAGCACCCACC---------AAGGCAAGGAGAAGA------GTGGT G---GAGAGAGGAAAAAGGGCA---GTTGGA---CTGGGAGCTGTCTTCC TTGGGTTCTTAGGAGCAGCAGGAAGCACTATGGGCGCGGGGTCAATAACG CTGACGGTACAGGTCAGACAATTATTGTCTGGCATAGTGCAACAGCAAAG CAATTTGCTGAGGGCTATAGAGGCGCAGCAACATCTATTGCAACTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTAGAAAGATAC CTAAAGGATCAACAGCTCCTAGGGATTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTAATGTGCCTTGGAACACTAGTTGGAGTAATAAATCTTATG AGGAG---ATTTGGGATAACATGACCTGGATACAATGGGAAAGGGAAGTC AGCAATTACACACAACAAATATACAGCCTAATTGAAGAATCGCAGAACCA GCAGGAAAAGAATGAACAAGACTTATTGGCATTGGACAAGTGGGCAAGTT TGTGGAACTGGTTTGACATAACAAAATGGCTATGGTATATAAAAATATTT ATAATGATAGTAGGAGGTTTAATAGGTTTAAGAATAGTTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCTTTGTCATTCCAGA CCCTTACCCACCACCAGAGG---GAACCCGACAGGCCCGAAAGAATCGAA GAAGGAGGTGGAGAGCAAGACAGAGACAGATCAGTGCGCTTAGTGAGCGG ATTCTTAGCACTTGCCTGGGACGACCTGCGGAACCTGTGCCTCTTCAGCT ACCACCGATTGAGAGACTTAGTCTTGATTGCAGCGAGGACAGCAGAACTC CTGAGACGCAGCAGTCTCCAGGGACTGAGACTGGGG---TGGGAGGGCCT C------AAATATCTGTGGAAT---------------------CTCCTGT TGTATTGGGGTCGGGAACTAAAGAATAGTGCTATTAATTTGATTGATACA ATAGCAATAGCAGTAGCTAACTGGACAGATAGGGTTATAGAAGTAGCACA AGGAGCTTGTAGAGCTATTCTCAACATACCTAGAAGGATAAGACAAGGCT TGGAAAGAGCTTTGCTATAA ; G-92NG083.2(jv10832 ATGAGAGTGAAGGGGATACAGAGGAATTGGCAACACTTATGGAAATGG-- ----------GGGACTTTGATCCTTGGGTTGGTAATAATTTGTAGTGCCT CA---GATAACTTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGGAA GATGCAGATACCCCCCTATTCTGTGCCTCTGATGCTAAATCATATAGTTC TGAAAAACATAATGTCTGGGCTACACATGCCTGTGTACCCACAGACCCTA ACCCACAAGAAATAGCTATAGAAAATGTAACAGAAAATTTTAACATGTGG AAGAATAACATGGTAGAACAGATGCAGGAGGATATAATCAGTTTATGGGA GGAAAGCCTAAAGCCATGTGTAAAGCTAACTCCTCTCTGTATCACTTTAA ACTGTACTAATGTAAACAGTGCTAATCATACTGAGGCCAATAACACTGTA GAA----------------------------------------------- -AACAAAGAAGAAATAAAAAACTGCTCTTTCAAGATAACCACAGAAAGGG GAGGCAAGAAGAAGGAAGAATACGCGCTTTTCTATAAACTTGATGTGGTA CCAATTAGTAAT------------GGGAATAAGACTAGT----------- ----------------TATAGGCTAATACATTGTAATGTCTCAACCATTA AACAGGCTTGTCCAAAGGTAAATTTTGACCCAATTCCCATACATTATTGT GCTCCAGCTGGTTTTGCGATTTTAAAGTGTAGGGATAAGGAGTACAATGG AACAGGACCATGTAAAAATGTCAGTACAGTACAATGTACACATGGAATTA AGCCAGTGGTATCAACTCAACTACTGCTGAATGGCAGTTTAGCAGAAGAA GATATAAGAATTAGATCTGAAAATTTCACAGACAATACCAAAGTCATAAT AGTGCAGCTTAATAATAGTATAGAAATTAATTGTATCAGACCCAATAACA ATACAAGAAAAAGTATACCAATC---------GGACCAGGACAAGCGTTC TATGCA---ACAGGTGAT------ATAATAGGAGACATA---AGACAAGC ACATTGTAATGTTAGTAGAATAAAATGGAGGGAGATGTTAAAGAATGTCA CAGCACAGCTAAGGAAA---------ATCTATAATAAT---------AAG AAC---------ATAACCTTTAACTCATCTGCA---GGAGGGGACCTAGA AATTACAACACATAGTTTCAATTGTAGAGGAGAGTTTTTCTATTGCAATA CATCAGGACTGTTTAATAATAATATT---AGTAAT------------ATT AATAATGAG------------------ACT------------------AT CACACTCCCATGTAAAATAAAACAAATTGTGAGGATGTGGCAGAAAGTGG GACAAGCAATGTATGCCCTTCCCATCGCAGGAAACCTTGTATGTAAATCA AACATTACAGGATTAATATTAACAAGAGATGGTGGGAATAAC---AAT-- -GACAGTACAGAGGAGACCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAGTATAAAACAGTAAAAATCAAATCACTA GGAGTAGCACCCACC---------AGGGCAAGGAGAAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTTGGA---CTGGGAGCTGTCTTCC TTGGGTTCTTAGGAGCAGCAGGGAGCACTATGGGCGCGGCGTCAATAACG CTGACGGCACAGGTCAGACAATTATTGTCTGGCATAGTGCAACAGCAAAG CAATTTGCTGAGGGCTATAGAGGCGCAGCAGCATCTGTTGCAACTCACAG TCTGGGGCATTAAACAGCTCCAGTCAAGAGTCCTGGCTATAGAAAGATAC CTAAAGGATCAACAGCTCCTAGGGATTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTAATGTGCCCTGGAACACTAGTTGGAGTAATAAATCTTATA ATGAG---ATTTGGGATAACATGACTTGGCTAGAATGGGAAAGGGAAATT CACAATTACACACAACACATATACAGCCTGATTGAAGAATCGCAGAACCA GCAGGAAAAGAATGAACAAGACTTATTGGCATTGGACAAGTGGGCAAGTT TGTGGAATTGGTTTGACATATCAAATTGGCTATGGTATATAAGAATATTC ATAATGATAGTAGGAGGTTTAATAGGTTTAAGAATAGTTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCTTTGTCGTTCCAGA CCCTTACCCATCACCAGCGG---GAACCCGACAGGCTCGGAAAAACCGAA GAAGGAGGTGGCGAGCAAGACAGAGACAGATCCACTCGATTAGTGAGCGG ATTCTTAGCGCTTGCCTGGGACGACCTGCGGAGCCTGTGCCTTTTCAGCT ACCACCGCTTGAGGGACTTAGTCTTGATTGCAGCAAGGACGGTGGAACTT CTGGGACGCAGCAGCCTCAAGGGACTGAGACTGGGG---TGGGAAGGCCT C------AAGTACTTGTGGAAC---------------------CTCCTGT TGTATTGGGGTCGGGAACTAAAGAATAGTGCTATTAATTTGCTTGATACA ATAGCAATAGCAACAGCTAACGGGACAGATAGGGTTATAGAAGTAGCACA AAGAGCTTATAGAGCTATTCTCAACGTACCTACAAGGATAAGACAAGGCT TAGAAAGAGCTTTGCTATAA ; G-92UG975.10 ----AAGTGAGGGGGATACAGATGAATTGGCAACACTTGTGGAAATGG-- ----------GGAACTTTGATCCTTGGGTTGGTGATAATGTGTAGTGCCT CA---AATAACTTGTGGGTCACAGTCTATTATGGGGTACCTGCGTGGGAA GATGCAGATACCATTCTATTTTGTGCATCTGATGCTAAAGCATATAGTAC TGAGAAACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCA ACCCACAAGAGCTACCCCTAAAAAATGTAACAGAAAATTTTAACATGTGG AAAAATAACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGA TGAAAGCCTAAAGCCATGTGTAAAACTAACCCCTCTCTGTGTCACTTTAC ACTGTGCTAATGTAACCAAC---------AATTATACT------------ ------GAATTAGCTAACACAAGCATT------------GGGAAC----- ----CGAGAAGAAATAAAAAACTGCTCTTTCAAGGTAACCACAGAACTAA GAAATAAACAGAAGGAAGAATACGCGCTTTTCTATAGAACTGATGTAATA CCAATTAATGATAATAGTAAA---------------AGTAGTGCTAGTAA TTATAGT------GATTATAGGTTAATAAATTGTAATGTCTCAACCATTA AACAGGCTTGTCCAAAGGTGTCTTTTGAACCAATTCCCATACACTATTGT GCTCCAGCTGGGTTTGCACTTTTAAAGTGTAAAGATAAGAAGTTCAATGG AACAGGACCATGTTACAATGTTAGTACAGTACAATGTACACATGGGATTA AGCCAGTGGTATCAACTCAATTCTTGCTGAATGGCAGTTTAGCAGAAGAA GAAATAATGATTAGATCTAAAAACCTTACAGATAATGCCAAAGTCATAAT AGTGCAGCTTAATGAAACTGTAGAAATTATATGCACCAGACCCAACAACA ATACAAGGAAAAGTATAAACTTA---------GGGCCAGGACAAGCAATC TATGCA---ACAGGGGCC------ATAATAGGAGATATA---AGACAGGC ACATTGTAATGTTAGTGGAGGAAATTGGAGTACAATGCTACAGAGGGTAA AAGCACAACTAGCAAGA---------ACCTTTAAC------------AAG AACATAACGAACATAATCTTTAACTCATCTGCA---GGAGGGGACCTAGA AATTACAACACATAGTTTTAATTGTGGGGGAGAATTTTTCTATTGTAATA CATCAAAACTATTTAATGATAGTATAGGTAGTGGG--------------- ---------------------------------------------AACAT CACACTCCCATGTAAGATAAAACAAATTGTAAGAATGTGGCAGAGAGTGG GACAAGCGATGTATGCCCCTCCCAGAGCAGGAAACATTACATGTAAATCA AACATTACAGGACTACTATTAACAAGAGATGGTGGATATAACAAT----- -------ACAAATGAGACCTTCAGACCTGCAGGAGGAGATATGAAAGACA ATTGGAGAAGTGAATTATATAAGTATAAAGTAGTAAAAATTAAACCACTA GGAGTAGCACCCACC---------AGGGCAAGGAGAAGA------GTAGT G---GGGAGAGAAAAAAGAGCA---GTTGGA---GTGGGAGCTGTCCTCT TTGGGTTCTTAGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATAACG CTGACGGTACAGGTCAGACAATTATTGTCTGGCATAGTGCAACAGCAAAG CAATTTGCTGAGAGCTATAGAAGCGCAGCAGCATCTGTTGCAGCTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTCTAGAAAGATAC CTAAGAGATCAACAGCTCCTAGGGATTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTAATGTGCCCTGGAACGCTAGTTGGAGTAATAAAAGTTATG AGGAG---ATTTGGGATAACATGACCTGGATACAATGGGACAGGGAAATT AACAATTACACACAACTAATATACAACCTGATTGAACAATCGCAGACCCA GCAAGAAAAGAATGAGCAAGACTTATTAGCATTGGACAAGTGGACAAGTC TGTGGAGTTGGTTTAGCATATCAAACTGGCTATGGTATATAAGAATATTT ATAATGATAGTAGGAGGTCTAATAGGTTTAAGAATAATTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCTTTGTCTTTCCAGA CCCTTCCCCACCACCAGAGG---GGACCCGACAGGCCAGAAGGAATCGAA GAAGGAGGTGGAGAGCAAGACAGAGACAGATCCATTCGATTAGTGAACGG ATTCTTAGCACTTGCCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCT ACCACCGCTTGAGAGACTCCATCTTGATTGCAGCGAGGACGGTGGAGCTT CTGGGACGCAACATTCTCCAGGGACTGAGACTGGGG---TGGGAGAGCCT C------AAATATCTGTGGAAT---------------------CTTCTGT TGTATTGGGGTCGGGAGCTAAAGAATAGTGCTATTAATTTGGTTGATACA ATAGCAGTAGCAGTAGCTAACTGGACAGATTGGGTTATAGAAATAGTACA AAGAGCTTGTAGGGCTATTCTCAACATACCTAGAAGGAT----------- -------------------- ; G-92RU131.9 ----GAGTGAAGGGGATACGGACGAATTGGCAACACTTCTGGAGATGG-- ----------GGAACTTTGATCCTTGGGTTGGTAATGATTTGTAGTGCCT CA---AAGGACTTGTGGGTCACAGTCTATTATGGGGTGCCTGTGTGGGAA GATGCAGATACCACTCTATTTTGTGCATCTGATGCTAAATCATATAGTAC TGAAAGCCATAATGTCTGGGCTACACATGCCTGTGTCCCCACAGACCCCA ACCCACAAGAGATAACTCTGGAAAATGTAACAGAAAATTTTAATATGTGG AAAAATAACATGGTAGAACAGATGCATGAGGATATAATCAGTCTATGGGA TGAAAGCCTAAAGCCATGTGTAAAGTTAACCCCTCTCTGTGTTACTTTAA ACTGTAGA---------------------AATGTAAGCTGTACTAATTGT ACTAAGGGAAACAACAATAGAACTGTG------------GAAGGC----- ----AAGGACGGAATGAAAAACTGCTCTTTCAATGTAACTACAGAAATAA GAGATAAGAAAAAGACAGAATACGCGCTTTTCTATAAACTTGATGTAGTA CCAATTAATGATGAA---------------------AGTAGT------AA TAGTACT---------TATAGGCTAATAAATTGTAATGTCTCAACCATTA AACAGGCTTGTCCAAAGGTGAATTTTGACCCAATTCCCATACATTATTGT GCTCCAGCTGGTTTTGCGATTTTAAAGTGTAGGGATAAGAATTTCACTGG AACAGGACCATGTAAAAATGTCAGTACAGTACAATGTACACATGGAATTA AGCCAGTGGTATCAACTCAATTATTGCTGAATGGCAGCTTAGCAGAAGAA GAAATAATAGTTAGATCTGAAAACTTCACAGACAATGCCAAAGTCATAAT AGTGCAGCTTAATAAATCTGTAGAAATTACATGTACCAGACCTAATAACA ATACAAGAAAAAGTATAACTTTT---------GCACCAGGACAAGCGCTC TATGCA---ACAGGTGAA------ATAATAGGAGATATA---AGACAAGC ACATTGTAATGTTAGTAGAAAAGATTGGAATGAGATGTTGCAGAATGTGA CTACAAAACTAAAAGGA---------ATCTTTAAC------------AAC ACA------AACATAACATATAACTCAGCTGCA---GGAGGAGATCTAGA AATTACAACACATAGTTTTAATTGTAGAGGAGAATTTTTCTATTGCAATA CATCAGGACTGTTTAATAATAGTGAG---AATAAC------------TCC ACTATC---GAGAATAACTCCACT------------------------AT CACACTCCCATGTAGGATAAAACAAATTATAAGAATGTGGCAGAGAGTGG GGCAAGCAATGTATGCCCCTCCCATCGCAGGAAACATCACATGTATTTCA AACATTACAGGACTACTATTAACAAGAGATGGTGGGAACAATAATAAC-- -AGCACAAATAATGAGACCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAGTATAAAGTAGTAAGAATTAAACCACTA GGAGTAGCACCCACC---------AGGGCAAGGAGAAGA------GTGGT G---GGGAGAGAAAAAAGAGCA---GTTGGA---CTGGGAGCTGTTTTCC TTGGGTTCTTAGGAGCAGCAGGAAGCACTACGGGCGCAGCGTCAATAACG CTGACGGTACAGGTCAGACAATTGTTGTCTGGCATAGTGCAACAGCAAAG CAATTTGCTGAGAGCTATAGAGGCGCAGCAGCATCTGTTGCAACTCACAG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTAGAAAAGTAC CTAAAGGATCAACAGCTCCTAGGAATTTGGGGCTGCTCTGGAAAACTCAT CTGCCCCACTAATGTGCCCTGGAACACTAGTTGGAGTAATAAATCTTTTA ATGAA---ATTTGGGATAACATGACCTGGATAGAATGGGAGAGAGAAATT AACAATTACACATACCAAATATACAACCTGCTTGAAGAATCGCAAAACCA ACAGGAAAAGGATGAACAAGACTTATTGGCATTGGACACGTGGGCAAGTC TGTGGAATTGGTTTACCATATCAAACTGGCTATGGTATATAAGAATATTT ATAATAGTAGTAGGAGGCTTAATAGGTTTAAAAATAGTTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCTTTATCATTCCAGA CCCTTACCCACCACCAGAGG---GAACCCGACAGGCCCGAAGGAATCGAA GAAGGAGGTGGAGAAGGAGGCAGAACCAGATCCATTCGATTAGCGAGCGG ATTCTTAGCTCTTGCGTGGGACGACCTGCGGAGCCTGTGCCTCTTCAGCT ACCACCGGTTGAGAGACTTCATATTGATTGCAGCGAGGACAGTGGAACTT CTGGGACGCAGCATTCTCAAGGGACTGAGACTAGGG---TGGGAGGGCCT C------AAATATCTGTGGAAT---------------------CTTCTGT TGTATTGGGGCCAGGAGCTAAAGAATAGTACTATTAGTTTGTTTGATACA ATAGCAATAACAGTAGCCAACTGGACAGATAGGGTTATAGAAGTAGTACA AAGAACTTGTAGAGCTATTCTTGACATACCTAGAAGAAT----------- -------------------- ; H-90CR056.1(u40561) ACGAGAGTGATGGAGACACAGAGGAATTATCCAAGCTTATGGAGATGG-- ----------GGCACCTTAATCTTGGGTATGTTGCTGATCTGTAGTGCTG CA---CAAAACTTGTGGGTTACAGTATATTATGGGGTACCTGTGTGGAAA GAGGCAAAAACCACTCTATTCTGTGCATCAGATGCTAAGGCATATGAGAC AGAAAAGCATAATGTCTGGGCTACACATGCATGTGTACCCACAGACCCCA ACCCACAAGAGATGGTCATGGAGAATGTAACAGAGAGCTTTAATATGTGG GAAAATAACATGGTGGAGCAGATGCATACAGACATAATCAGTTTATGGGA TCAAAGCTTGAAACCATGTGTAAAATTAACCCCACTCTGTGTTACTCTAA ACTGTACTAATGTCAGA------------AACAATACCTCTAAC------ ---------------AGCACTAGCAGT------------------ATGGA GGCAGGAGGGGAACTAACAAATTGCTCTTTCAATGTAACTACAGTACTAA GAGATAAGCAGCAGAAAGTACATGCACTCTTTTATAGACTTGATGTAGTA CCAATTGATAAC---------------------AATAGTACT-------- -------------CAGTATAGGCTAATAAATTGTAATACCTCAGTCATTA CACAGGCTTGCCCAAAGGTGTCCTTTGAACCTATTCCCATACATTATTGT GCTCCAGCTGGCTTTGCGATTCTAAAGTGTAACAATAAAACATTCAATGG AACAGGATTATGTACAAATGTCAGTACAGTACAATGTACACATGGAATTA GACCAGTGGTATCAACTCAACTGCTATTAAATGGAAGCCTAGCAGAAGAA CAGATCATAATTAGAACTAAAAATATCTCAGACAATACCAAAAACATAAT AGTACAGCTTAAGACACCAGTAAACATTACATGTACCAGGCCTAACAATA ATACGAGAACAAGTATACATTTA---------GGGCCAGGACGAGCATTC TATGCA---ACAGGTGAC------ATCATAGGAGATATA---AGACAAGC ACATTGTAATATTAGTAGAACAGACTGGAATAAGACTTTACACCAGGTAG TTACACAATTAGGAATA---------CACTTGAACAAT---------AGA ACA---------ATAAGCTTTAAGCCAAACTCA---GGAGGGGACATGGA AGTTAGAACACATAGTTTTAATTGTAGAGGAGAATTTTTCTATTGCAATA CATCAGGGCTGTTTAATAGTAGTTGG---GAAATGCAT---------ACT AATTACACATCAAATGACACAAAGGGAAAC---GAAAAC---------AT TACACTGCCATGCAGAATAAAACAAATTGTAAACATGTGGCAGAGAGTAG GACGAGCAATGTATGCCCCTCCCATCCAAGGAAACATTATGTGTGTATCA AATATTACAGGACTAATATTGACAATTGACGAGGGTAACGCG-------- -TCTGCAGAAAATTATACCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTGTATAAATATAAAGTAGTAAAAATTGAACCACTG GGAATAGCACCCACC---------AAGACAAGGAGAAGA------GTGGT G---GAGAGAGAAAAAAGAGCA---GTGGGA---ATGGGAGCTTCTTTCC TTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCCAGGCAATTATTGTCTGGTATAGTGCAGCAGCAAAG CAATTTGCTGAGAGCTATACAGGCGCGACAGCATATGTTGCAGCTCACGG TCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTCGCTGTGGAAAGATAC CTAAGGGATCAACAGCTCCTGGGGATTTGGGGCTGCTCTGGAAAACTCAT CTGCACCACTAATGTGCCTTGGAACTCTAGTTGGAGTAATAAATCACAGA GTGAA---ATCTGGGACAACATGACTTGGATGGAATGGGATAAACAAATT AGCAATTACACAGAGGAAATATACAGGTTGCTTGAAGTCTCGCAAACCCA GCAGGAAAAGAATGAACAGGACTTATTAGCATTGGACAAATGGGCAAGTC TGTGGACTTGGTTTGACATATCACATTGGCTGTGGTATATAAAAATATTC ATAATGATAGTAGGAGGTTTAATAGGTTTAAGAATAATTTTTGCTGTGCT TTCTATAGTAAATAGAGTTAGGCAGGGATACTCACCTTTGTCTTTTCAGA CCCTTGTCCCGAACCCACGG---GGACCCGACAGGCCCGAAGGAACAGAA GAAGGAGGTGGCGAGCAAGACAGAGACAGATCCGTGAGATTAGTGAACGG ATTCTTACCAGTTGTCTGGGACGACCTCCGGAGCCTGTCACTCTTCAGCT ACCGCCTCTTGAGAGACTTACTCTTAATTGTAGTGAGGACTGTGGAACTT CTGGGGAGAAGG---------------------GGG---AGGGAAGCCCT C------AAATATCTCTGGAAT---------------------CTTCTAC AATACTGGGGACAGGAACTAAAGAATAGTGCTATTGATTTGCTTAACACC ACAGCAATAGCAGTAGCTGAGGGAACAGATGGGATTATAGTAATAGTGCA AAGAGCTTGGAGAGCTATTCTCCACATACCTAGAAGAATAAGACAGGGCT TTGAAAGAAGCTTGCTATAA ; H-VI557 -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -----------------------------------------------AAC CATGTAATAATTAGATCTAAAAATATCACAGACAATACCAAAAACATAAT AGTACAGCTTAAAAGTCCTGTACCAATTAACTGTACCAGACCCAACAATA ATACGAGAAAAAGTATAAGTATA---------GGGCCAGGACAAGCATTC TATGCA---ACAGGTGAC------ATCATAGGAGATATA---AGAAAAGC ATATTGTAATATTACTAGGGAAGATTGGAAAAGGACTTTACATGAGGTAG TTCAGCAATTAAGAGAA---------CACTTTAAT------------AAT CAAACA------ATAATTTTCGAACCATCCTCA---GGAGGGGACATGGA AATTACAATGCATACTTTTAATTGTAGAGGAGAATTTTTCTATTGCAATA CATCAAAATTGTTTAACAGTACTTGG---GTTAACAGT------ACATCA AATGATATCTCAAATGGCACAACAATA---------------------AT TGAACTGCCATGCAGAATAAAACAAATTATAAACATGTGGCAGAGAGTAG GACAAGCAATGTATGCCCCTCCCATCAAAGGAAAAATTACATGTGAATCA AATATTACAGGGCTAATATTGACAAGTGATCATGTTAATTCTGCA----- ----GAAAGTAATGTTACCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAGAGTCGAACCACTA GGATTAGCACCCACC---------AGGGCAAGGAGAAGA------GTGGT G---GAAAGAGAAAAAAGAGCT---GTGGGA---CTGGAAGCTGTTTTCC TTGGGTTCTTGGGAGCAGCAGGGAGCACTATGGGCGCGGCGTCAGTGACG CTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAG CAATTTGCTGCAAGCTATACAGGCACAACAGCATATGTTGAAGCTCACG- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------- ; H-CA13 -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -----------------------------------------------GAA AAGGTAATGATCAGATCTGAAAATATCACAGACAATACCAAAAACATAAT AGTACAGCTTAAAAATCCTGTAGTAATTAACTGTACCAGACCCAACAATA ACACGAGAAGAAGTATGCGTATA---------GGTATAGGACGAGGACAA ACATTC---CATGCAATAGGTGCTATAATAGGAGATATA---AGACAAGC ACATTGTAATATTAGTGGAGCAAAGTGGAATGACATGTTAACCAAGGTAG CTACACAATTAGGAAAA---------CACCTGAAC------------AAG AGCAAA------ATACAATTTAAACCATCCTCA---GGAGGAGACATAGA AATTATAACACACATGTTTAACTGTGCAGGAGAATTTTTCTATTGTAATA CAACAAAACTGTTTAATAGTACCTGGACGACTAACACC------AATGGC AGCTATGTGAGCAATAACACA---------------GAAAATGGTACTAT TACACTGCAATGCAGAATAAAACAAATTGTAAGCATGTGGCAGAGAGCAG GACAAGCAATGTATGCCCCTCCCATCAATGGAAAGATTACATGTGTATCA AATATTACAGGACTAATATTGACAAGTGACCATGTTAATCGGTCT----- ----GCAGAGGAGGTGACCTTCAGACCTGGAGGAGGAGATATGAGGGACA ATTGGAGAAGTGAATTATATAAATATAAAGTAGTGAAAATTGAACCACTA GGAGTAGCACCCACT---------AAGGCAAAGAGAAGA------GTGGT G---GGGAGAGAAAAAAGAGCA---GTTGGA---CTAGGAGCTGTCTTCC TTGGGTTCTTAGGAGCAGCAGGAAGCACTATGGGCGCGGCGTCAATAACG CTGACGGTACAGGCTAGACAATTATTGTCTGGCATAGTGCAACAGCAAAG TAATTTGCTGAGGGCTATAGAGGCTCAACAGCATCTGTTGAAACTCACA- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------- ; J-SE7022 -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ------ATAATTAGATCTGAAAATATCTCAGACAATGCYAAAAACATAAT AGTACAACTTAATGAYACTGTAAAAATTGTGTGTACCAGACCCTATAACA ACACAAGGGAAAGTATACACATG---------GGACCAGGACAAGTGCTC TACGCA---ACAGGGGAA------ATAATAGGAAATATA---AGAGAAGC ACATTGTAACATTAGTGRAAGAGATTGGAATAACACTTTACGTAGAGTAG CTACAAAACTAAGAGAA---------YACTTTAAT------------AAA ACA----------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------- ; J-SE7887 -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- ------ATAATTAGATCTGAAAATATCTCAGACAATGCCAAAAACATAAT AGTACAACTTAATAAAACTGTAGAAATTGTRTGTAACAGACCTAATAACA ACACAAGRAAAGGTATACACATG---------GGACCAGGACAAGTGCTC TACGCA---ACAGGGGAA------ATAATAGGAAATATA---AGAGAAGC ACATTGTAACATTAGTGAAAGAGATTGGAATAACACTTTACGTAGAGTAG CTACAAAACTAAGAGAA---------CACTTTAAT------------AAA ACA----------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------- ; O-ANT70 ATGAAAGCAATGGAGAAGAGGAACAAGAAGTTA------TGGACCTTG-- -------------TACTTAGCCATGGCTTTGATAACCCCATGTTTGAGCC TT---AGACAGCTATATGCAACAGTCTATGCTGGGGTGCCTGTATGGGAA GATGCAACACCAGTACTATTCTGTGCTTCAGATGCTAACCTAACAAGCAC TGAAAAGCATAATATTTGGGCATCACAAGCCTGTGTTCCTACAGACCCCA CTCCATATGAATATCCATTGCACAATGTGACAGATGACTTTAATATATGG AAAAATTACATGGTAGAACAAATGCAGGAAGACATTATTAGTTTATGGGA CCAGAGTCTTAAACCTTGTGTTCAAATGACTTTCCTGTGTGTACAAATGG AGTGT---------------------ACAAACATAGC------------- --------------------------------------TGGAACAACAAA TG---AAAACCTTATGAAGAAGTGTGAGTTTAATGTAACCACTGTTATCA AAGACAAAAAGGAGAAAAAACAGGCTCTATTCTATGTATCAGATTTGATG GAACTGAATGAGACAAGCAGC---ACAAATAAGACAAACAGCAAA----- -------------ATGTATACATTAACTAATTGTAACTCCACAACCATCA CGCAAGCCTGTCCAAAGGTATCTTTTGAACCAATTCCAATACACTATTGT GCTCCAGCAGGATATGCTATCTTTAAGTGTAACAGCACAGAATTTAATGG AACAGGCACATGCAGAAACATAACGGTAGTTACTTGTACACATGGCATTA GGCCAACAGTAAGTACTCAGCTAATATTAAATGGGACACTCTCTAAAGGA AAAATAAGAATGATGGCAAAAGATATTTTGGAAGGTGGAAAAAATATCAT AGTGACCCTAAACTCTACCCTAAACATGACCTGTGAAAGACCACAAATAG AC---ATACAAGAGATGAGAATA---------GGTCCAATGGCCTGGTAC AGCATGGGAATAGGGGGAACA------GCAGGAAACAGCTCAAGGGCAGC TTATTGCAAGTATAATGCCACTGATTGGGGAAAAATATTAAAACAAACAG CTGAAAGGTATTTAGAA---------CTAGTAAACAATACAGGTAGTATT AAC---------ATGACATTCAATCACAGCAGC---GGTGGAGATCTAGA GGTAACCCATTTACACTTTAACTGTCATGGAGAATTCTTTTATTGTAACA CAGCTAAGATGTTTAATTATACCTTT---TCATGTAACGGA------ACC ACCTGTAGTGTTAGTAATGTTAGTCAA------GGTAAC------AATGG CACTCTACCTTGCAAACTGAGACAGGTGGTAAGGTCATGGATAAGGGGAC AGTCGGGACTCTATGCACCTCCCATCAAAGGTAATCTAACATGTATGTCA AACATAACTGGAATGATCCTACAAATGGATAACACATGGAAC---AGC-- -AGCAACAACAATGTAACATTTAGACCAATAGGGGGAGACATGAAAGATA TATGGAGAACTGAATTGTTCAACTACAAAGTAGTAAGGGTAAAACCTTTT AGTGTGGCACCCACACGTATTGCAAGGCCAGTCATAAGCACTAGAACT-- ----CATAGAGAAAAAAGAGCA---GTAGGA---TTGGGAATGCTATTCT TGGGGGTTCTAAGTGCAGCAGGTAGCACTATGGGCGCAGCGGCAACAACG CTGGCGGTACAGACCCACACTTTGCTGAAGGGTATAGTGCAACAGCAGGA CAACCTGCTAAGAGCAATACAGGCCCAGCAGCAATTGCTGAGGCTATCTR TATGGGGTATCAGACAACTCCGAGCTCGCCTGCTAGCCTTAGAAACCTTA CTACAGAATCAGCAACTCCTAAGCCTATGGGGCTGTAAAGGAAAGCTAGT CTGCTACACATCAGTAAAATGGAATAGAACATGGATAGGA------AACG AAAGC---ATTTGGGACACCTTAACATGGCAGGAATGGGATCGGCAGATA AGCAACATAAGCTCCACCATATATGAGGAAATACAAAAGGCACAAGTACA GCAGGAACAAAATGAGAAAAAGTTGCTGGAGTTAGATGAATGGGCCTCTA TTTGGAATTGGCTTGACATAACTAAATGGTTGTGGTATATAAAAATAGCA ATAATCATAGTAGGAGCACTAGTAGGGGTGAGAGTTATCATGATAGTACT TAATATAGTGAAAAACATTAGGCAGGGATATCAACCCCTCTCGTTACAGA TCCCCAACCATCACCAAGAG---GAAGCAGGAACGCCAGGAAGAACAGGA GGAGGAGGTGGAGAAGAAGGCAGGCCCAGGTGGATACCCTCGCCGCAAGG GTTCTTGCCACTGTTGTACACGGACCTCAGAACAATAATATTGTGGACTT ACCACCTCTTGAGCAACTTA------GCATCAGGG---ATC--------- ------CAGAAGGTGATCAGCTATCTGAGGCTTGGACTGTGG---ATCCT AGGGCAGAAGATAATT---AATGTTTGCAGAATTTGTGCAGCTGTAACAC AATACTGGCTACAAGAATTGCAGAATAGTGCTACAAGCTTGCTAGACACA CTTGCAGTGGCAGTAGCCAATTGGACTGACGGCATAATCGCAGGGATACA AAGAATAGGAACAGGAATTCGTAACATCCCAAGGAGAATTAGACAGGGCT TAGAAAGAAGTTTATTGTAA ; O-MVP5180 ATGAAAGTAATGAAGAAGAACAACAGGAAGTCA------TGGAGCTTA-- -------------TACATAGCCATGGCTTTGCTAATCCCATGTTTGAGTT ATAGTAAACAATTGTATGCCACAGTTTATTCTGGGGTACCTGTATGGGAA GAGGCAGCACCAGTACTATTCTGTGCTTCAGATGCTAACCTAACAAGCAC TGAACAGCATAATATTTGGGCATCACAAGCCTGCGTTCCTACAGATCCCA ATCCACATGAATTTCCACTAGGCAATGTGACAGATAACTTTGATATATGG AAAAATTACATGGTGGACCAAATGCATGAAGACATCATTAGTTTGTGGGA ACAGAGTTTAAAGCCTTGTGAGAAAATGACTTTCTTATGTGTACAAATGA ACTGTGTAGATCTG---------CAAACAAATAAAACA------------ ------------------------------------GGCCTATTAAATGA GACAATAAATGAGATGAGAAATTGTAGTTTTAATGTAACTACAGTCCTCA CAGACAAAAAGGAGCAAAAACAGGCTCTATTCTATGTATCAGATCTGAGT AAGGTTAATGACTCA------------AATGCAGTAAATGGAACA----- -------------ACATATATGTTAACTAATTGTAACTCCACAATTATCA AGCAGGCCTGTCCGAAGGTAAGTTTTGAGCCCATTCCCATACACTATTGT GCTCCAACAGGATATGCCATCTTTAAGTGTAATGACACAGACTTTAATGG AACAGGCCTATGCCACAATATTTCAGTGGTTACTTGTACACATGGCATCA AGCCAACAGTAAGTACTCAACTAATACTGAATGGGACACTCTCTAGAGAA AAGATAAGAATTATGGGAAAAAATATTACAGAATCAGCAAAGAATATCAT AGTAACCCTAAACACTCCTATAAACATGACCTGCATAAGAGAAGGAATTG CAGAGGTACAAGATATATATACA---------GGTCCAATGAGATGGCGC AGTATGACACTTAAAAGAAGTAACAATACATCACCAAGATCAAGGGTAGC TTATTGTACATATAATAAGACTGTATGGGAAAATGCCCTACAACAAACAG CTATAAGGTATTTAAATCTTGTAAACCAAACAGAGAAT---------GTT ACC---------ATAATATTCAGCAGAACTAGT---GGTGGAGATGCAGA AGTAAGCCATTTACATTTTAACTGTCATGGAGAATTCTTTTATTGTAACA CATCTGGGATGTTTAACTATACTTTT---ATCAACTGTACAAAGTCCGGA TGCCAGGAGATCAAAGGGAGCAATGAGACCAATAAA---------AATGG TACTATACCTTGCAAGTTAAGACAGCTAGTAAGATCATGGATGAAGGGAG AGTCGAGAATCTATGCACCTCCCATCCCCGGCAACTTAACATGTCATTCC AACATAACTGGAATGATTCTACAGTTAGATCAACCATGGAAT---TCC-- ----ACAGGTGAAAATACACTTAGACCAGTAGGGGGAGATATGAAAGATA TATGGAGAACTAAATTGTACAACTACAAAGTAGTACAGATAAAACCTTTT AGTGTAGCACCTACAAAAATGTCAAGACCAATAATAAACATTCACACCCC T---CACAGGGAAAAAAGAGCA---GTAGGA---TTGGGAATGCTATTCT TGGGGGTGCTAAGTGCAGCAGGTAGCACTATGGGCGCAGCGGCAACAGCG CTGACGGTACGGACCCACAGTGTACTGAAGGGTATAGTGCAACAGCAGGA CAACCTGCTGAGAGCGATACAGGCCCAGCAACACTTGCTGAGGTTATCTG TATGGGGTATTAGACAACTCCGAGCTCGCCTGCAAGCCTTAGAAACCCTT ATACAGAATCAGCAACGCCTAAACCTATGGGGCTGTAAAGGAAAACTAAT CTGTTACACATCAGTAAAATGGAACACATCATGGTCAGGAAGATATAATG ATGACAGTATTTGGGACAACCTTACATGGCAGCAATGGGACCAACACATA AACAATGTAAGCTCCATTATATATGATGAAATACAAGCAGCACAAGACCA ACAGGAAAAGAATGTAAAAGCATTGTTGGAGCTAGATGAATGGGCCTCTC TTTGGAATTGGTTTGACATAACTAAATGGTTGTGGTATATAAAAATAGCT ATAATCATAGTGGGAGCACTAATAGGTATAAGAGTTATTATGATAATACT TAATCTAGTGAAGAACATTAGGCAGGGATATCAACCCCTCTCGTTGCAGA TCCCTGTCCCACACCGGCAG---GAAGCAGAAACGCCAGGAAGAACAGGA GAAGAAGGTGGAGAAGGAGACAGGCCCAAGTGGACAGCCTTGCCACCAGG ATTCTTGCAACAGTTGTACACGGATCTCAGGACAATAATCTTGTGGACTT ACCACCTCTTGAGCAACTTA------ATATCAGGG---ATC--------- ------CGGAGGCTGATCGACTACCTGGGACTGGGACTGTGG---ATCCT GGGACAAAAGACAATT---GAAGCTTGTAGACTTTGTGGAGCTGTAATGC AATATTGGCTACAAGAATTGAAAAATAGTGCTACAAACCTGCTTGATACT ATTGCAGTGTCAGTTGCCAATTGGACTGACGGCATCATCTTAGGTCTACA AAGAATAGGACAAGGATTCCTTCACATCCCAAGAAGAATTAGACAAGGTG CAGAAAGAATCTTAGTGTAA
last modified: Fri Aug 10 14:02 2007


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health