HIV Databases HIV Databases home HIV Databases home
HIV sequence database



>01_AE.JP.93.93JP-NH1 ACC AB052995 ATGAGAGTGAAGGAGACACAGATGAATTGGCCAAACTTGTGGAAATG------------------GGGGACTTTGATCCT TGGGTTGGTGATAATTTGTAGTGCCTCAGATAACTTGTGGGTTACAGTTTATTATGGGGTTCCTGTGTGGAGAGATGCAG At--ACCACCC-TATTTTGTGCATCAGATGCCAAAGCACATGAGACAGAAGTGCACAATGTCTGGGCCACACATGCCTGT GTACCCACAGACCCCAACCCACAAGAAATACACCTGGAAAATGTAACAGAAAATTTTAACATGTGGAAAAATAACATGGT AGAGCAGATGCAGGAGGATGTAATCAGTTTATGGGATCAAAGTCTAAAGCCATGTGTAAAGTTAACTCCTCTCTGCGTTA CTTTAAATTGTACCAATGCt--AAtttg-----------Ac--CAATGt---CAA-TA-ACACAA-CCAATGTCTc--TA ACAc--AAt--AGg--AAAt---ATAACA-GAT-GA-AGTAA-GAAACTGTACTTTTAATATGACCACAGAACTAAACGA TAAGAAGAAGATGGTCCATGCACTTTTTTATAAGCTTGATATAGTACAAATAGAAAAT---------------------- ----Aa--TAGTAATAGTAAg--TATAGG-T-TAATAAATTGTA-ATACTTCAGTCATTAAGCAGGCTTGTCCAAAGATA TCCTTTGATCCAATTCCTATACATTATTGTACTCCAGCTGGTTATGCGATTTTAAAGTGTAATGATAAGAATTTCAATGG GACAGGGCCATGTAAAAATGTCAGTTCAGTACAATGCACACATGGAATTAAGCCAGTGGTATCAACTCAATTGCTGTTAA ATGGCAGTCTAGCAGAAGAAGAGATAATAATCAGATCTGAAAATCTCACAGACAATGCCAAAACCATAATAGTGCACCTT AATAAATCTGTAGAAATCAATTGTACCAGACCCTCCGAGAATAGAAGAACACGTATAACTATG------GGACCAGGACG AGTATGGTATAGAACAGGAGACATAATAGGAGATATAAGAAAAGCATATTGTAAGATTAATGGAACAAAATGGAATAAAG TTTTAAAACAGGTAACTGa--AAAATTGAAAGAGCACTTTA-At--AAT---AAGACAATAATCTTTCAA-CCACCCTCA GGAGGAGATCCAGAAATTACAATGCATCATTTTAATTGTAGAGGGGAATTTTTCTATTGCAATACAACACAACTGTTTAA TAGTACTTGC----------ATA--------------AGAAATGAAACC--------AA-GGAGGGg--Tg--TAATGGC ACTATCACACTTCCATG-CA-GGATAAAGCAAATTATAAACATGTGGCAGGGAGCAGGACAAGCAATGTATGCTCCTCCC ATCAGTGGAAAAATTAATTGTGTATCAAATATTACAGGAGTACTATTGACAAGAGATGGTGGTGCTAATAAG-------- ---------ACGAAt--AACGAGACCTTCAGACCTGGAG-GAGGAA-ATATAAAGGACAATTGGAGAAGTGAATTATATA AATATAAAGTAGTACAAATTGAACCACTAGGAATAGCACCCACCAGGGCAAAGAGAAGAGTGGTGGAGAGAGAAAAAAGA GCAGTGGGA-ATAGGAATTa--TGATCTTTGGGTTCTTAGG-AG-CAGCAGGAAG-CACTATGGGCGCGGCGTCAATAAC GCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAGCAATTTGCTGAGGGCTATAGAGGCGCAGC AGCATCTGTTGCAACTCACAGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAAGGAT CAAATGTTCCTAGGACTTTGGGGCTGCTCTGGAAAAATCATCTGCACCACTGCTGTGCCCTGGAACTCCACTTGGAGTAA TAAATCTTTTGAAGAGATTTGGAACAACATGACATGGATAGAATGGGAGAGAGAAATTAGCAATTACACAAACCTAATAT ATGGGATACTTACAGAATCGCAGAACCAGCAGGACAGGAATGAAAAAGAGTTGTTAGAATTGGATAAATGGGCAAGTCTG TGGAATTGGTTTGACATAACAAAGTGGCTGTGGTATATAAAAATATTTATAATGATAGTAGGAGGTTTAATAGGTTTAAG AATAATTTTTGCTGTGCTTTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCTTTGTCTCTCCAGACCCCTTCCCATC ATCAGAGGGAACCCGACAGACCCGAAAGAATCGAAGAAGAAGGTGGCGAGCAAGGCAGAGACAGATCCGTGCGATTAGTG ACCGGATTCTTAGCACTTGCCTGGGACGATCTACGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTCATCTT GATTGTAGCGAGGACTGTGGAACTTCTGGGACGCAGCAGTCTCAAGGGACTGAGCCGGGGGTGGGAAGGCCTCAAATATC TGGGGAACCTTCTGTTATATTGGAGCCAGGAACTAAGAATTAGTGCTATTTCTTTGCTTGATGCTACAGCAATAGCAGTA GCGGGGTGGACAGATAGGGTTATAGAAGTAGCACAGGGAGCTTGGAGAGCCATTCTCCACATACCTAGAAGAATCAGACA GGGCTTAGAAAGGGCTTTGGTATAA >01_AE.JP.93.NH25 ACC AB070352 ATGAGAGTGAAGGAGACACAGATGAATTGGCCAAACTTGTGGAAATG------------------GGGGACTTTGATCCT TGGGTTGGTAATAATTTGTAGTGCCTCAGACAACTTGTGGGTTACAGTTTATTATGGGGTTCCTGTGTGGAGAGATGCAG AT--ACCACCC-TATTTTGTGCATCAGATGCCAAAGCACATGAGACAGAAGTGCACAATGTCTGGGCCACACATGCCTGT GTACCCACAGACCCCAACCCACAAGAAATACACCTGGAAAATGTAACAGAAAATTTTAACATGTGGAAAAATAACATGGT AGAGCAGATGCAGGAGGATGTAATCAGTTTATGGGATCAAAGTCTAAAGCCATGTGTAAAGTTAACTCCTCTCTGCGTTA CTTTACATTGTACCAATGCT--AATTTG-----------AC--CAATGT---CAA-TA-ACATAA-CCAATGTCTC--TA ACAT--AAT--AGG--AAAT---ATAACA-GAT-GA-AGTAA-GAAACTGTACTTTTAATATGACCACAGTACTAAAAGA TAAGAAGCAGAAGGTCCATGCACTTTTTTATAAGCTTGATATAGTACAAATAGAAGAT---------------------- ----AA--GAATAGTAGTAAG--TATAGG-T-TAATAAATTGTA-ATACTTCAGTCATTAAGCAGGCTTGTCCAAAAATA TCCTTTGATCCAATTCCTATACATTATTGTACTCCAGCTGGTTATGCGATTTTAAAGTGTAATGATAAGAATTTCAATGG GACAGGGCCATGTAAAAATGTCAGTTCAGTACAATGCACACATGGAATTAAGCCAGTGGTATCAACTCAATTGCTGTTAA ATGGCAGTCTAGCAGAAGAAGAGATAATAATCAGATCTGAAAATCTCGCAAACAATGCCAAAACCATAATAGTGCACCTT AATAAATCCGTAGAAATCAATTGTACCAGACCCTCCAACAATACAAGCACAAGTATAACTATA------GGACCAGGACA AGTATGGTATAGAACAGGAGACATAATAGGAAATATAAGAAAAGCATATTGTGAGATTAATGGAACAAAATGGAATAAAG TTTTAAAACAGGTAACTGA--AAAATTGAAAGAGCACTTTA-AG--AAT---AAGACAATAATCTTTCAA-CCACCCTCA GGAGGAGATCCAGAAATTACAATGCATCATTTTAATTGTAGAGGGGAATTTTTCTATTGCAATACAACACAACTGTTTAA TAATACTTGC----------ATA--------------GGAAATGAAACC--------AA-GGAGGGG--TG--TAATGGC ACTATCACACTTCCATG-CA-AGATAAAGCAAATTATAAACATGTGGCAGGGAGCAGGACAAGCAATGTATGCTCCTCCC ATCAGAGGAATAATTAATTGTGTATCAAATATTACAGGAATACTATTAACAAGAGATGGTGGTGCTAATAAT-------- ---------ACGAAT--AACGAGACCTTCAGACCTGGAG-GAGGAA-ATATGAAGGACAATTGGAGAAGTGAATTATATA AATATAAAGTAGTACAAATTGAACCACTAGGAATAGCACCCACCAGGGCAAAGAGAAGAGTGGTGGAGAGAGAAAAAAGA GCAGTGGGA-ATAGGAGCTA--TGATCTTTGGGTTCTTAGG-AG-CAGCAGGAAG-CACTATGGGCGCGGCGTCAATAAC GCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAGCAATTTGCTGAGGGCTATAGAGGCGCAGC AGCATCTGTTGCAACTCACAGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAAGGAT CAAAAGTTCCTAGGACTTTGGGGCTGCTCTGGAAAAATCATCTGCACCACTGCTGTGCCCTGGAACTCCACTTGGAGTAA TAAATCTTTTGAAGAGATTTGGAACAACATGACATGGATAGAATGGGAGAGAGAAATTGGCAATTACACAAACCTAATAT ATGAGATACTTACAGAATCGCAGAACCAGCAGGACAGGAATGAAAAGGATTTGTTAGAATTGGATAAATGGGCAAGTCTG TGGAATTGGTTTGACATAACAAATTGGCTGTGGTATATAAAAATATTTATAATGATAGTAGGAGGTTTAATAGGTTTAAG AATAATTTTTGCTGTGCTTTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCTTTGTCTTTCCAGACCCCTTCCCATC ATCAGAGGGAACCCGACAGACCCGAAAGAATCGAAGAAGGAGGTGGCGAGCAAGGCAGAGACAGATCCGTGCGATTAGTG ACCGGATTCTTAGCTCTTGCCTGGGACGACCTACGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTCATCTT GATTGTAGCGAGGACTGTGGAACTCCTGGGACGCAGCAGTCTCAAGGGACTGAGACGGGGGTGGGAAGGCCTCAAATATC TGGGGAACCTTCTGTTATATTGGGGCCAGGAACTAAAAATTAGTGCTATTTCTTTGCTTGATACTACAGCACTAGCAGTA GCGGGGTGGACAGATAGGGTTATAGAAGTAGCACAGGGAGCTTGGAGAGCCATTCTCCACATACCTAGAAGAATCAGACA GGGCTTAGAAAGGGCTTTGGTATAA >01_AE.JP.93.NH2 ACC AB070353 ATGAGAGTGAAGGAGACACAGATGAATTGGCCAAACTTGTGGAAATG------------------GGGGACTTTGATCCT TGGGTTGGTAATAATTTGTAGTGCCTCAGACAACTTGTGGGTTACAGTTTATTATGGGGTTCCTGTGTGGAGAGATGCAG AT--ACCACCC-TATTTTGTGCATCAGATGCCAAAGCACATGAGACAGAAGTGCACAATGTCTGGGCCACACATGCCTGT GTACCCACAGACCCCAACCCACAAGAAATACACCTGGAAAATGTAACAGAAAATTTTAACATGTGGAAAAATAACATGGT AGAGCAGATGCAGGAGGATGTAATCAGTTTATGGGATCAAAGTCTAAAGCCATGTGTAAAGTTAACTCCTCTCTGCGTTA CTTTACATTGTACCAATGCT--AATTTG-----------AC--CAATGT---CAA-TA-ACATAA-CCAATGTCTC--TA ACAT--AAT--AGG--AAAT---ATAACA-GAT-GA-AGTAA-GAAACTGTACTTTTAATATGACCACAGTACTAAAAGA TAAGAAGCAGAAGGTCCATGCACTTTTTTATAAGCTTGATATAGTACAAATAGAAGAT---------------------- ----AA--GAATAGTAGTAAG--TATAGG-T-TAATAAATTGTA-ATACTTCAGTCATTAAGCAGGCTTGTCCAAAAATA TCCTTTGATCCAATTCCTATACATTATTGTACTCCAGCTGGTTATGCGATTTTAAAGTGTAATGATAAGAATTTCAATGG GACAGGGCCATGTAAAAATGTCAGTTCAGTACAATGCACACATGGAATTAAGCCAGTGGTATCAACTCAATTGCTGTTAA ATGGCAGTCTAGCAGAAGAAGAGATAATAATCAGATCTGAAAATCTCGCAAACAATGCCAAAACCATAATAGTGCACCTT AATAAATCCGTAGAAATCAATTGTACCAGACCCTCCAACAATACAAGCACAAGTATAACTATA------GGACCAGGACA AGTATGGTATAGAACAGGAGACATAATAGGAAATATAAGAAAAGCATATTGTGAGATTAATGGAACAAAATGGAATAAAG TTTTAAAACAGGTAACTGA--AAAATTGAAAGAGCACTTTA-AG--AAT---AAGACAATAATCTTTCAA-CCACCCTCA GGAGGAGATCCAGAAATTACAATGCATCATTTTAATTGTAGAGGGGAATTTTTCTATTGCAATACAACACAACTGTTTAA TAATACTTGC----------ATA--------------GGAAATGAAACC--------AA-GGAGGGG--TG--TAATGGC ACTATCACACTTCCATG-CA-AGATAAAGCAAATTATAAACATGTGGCAGGGAGCAGGACAAGCAATGTATGCTCCTCCC ATCAGAGGAATAATTAATTGTGTATCAAATATTACAGGAATACTATTAACAAGAGATGGTGGTGCTAATAAT-------- ---------ACGAAT--AACGAGACCTTCAGACCTGGAG-GAGGAA-ATATGAAGGACAATTGGAGAAGTGAATTATATA AATATAAAGTAGTACAAATTGAACCACTAGGAATAGCACCCACCAGGGCAAAGAGAAGAGTGGTGGAGAGAGAAAAAAGA GCAGTGGGA-ATAGGAGCTA--TGATCTTTGGGTTCTTAGG-AG-CAGCAGGAAG-CACTATGGGCGCGGCGTCAATAAC GCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAGCAATTTGCTGAGGGCTATAGAGGCGCAGC AGCATCTGTTGCAACTCACAGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAAGGAT CAAAAGTTCCTAGGACTTTGGGGCTGCTCTGGAAAAATCATCTGCACCACTGCTGTGCCCTGGAACTCCACTTGGAGTAA TAAATCTTTTGAAGAGATTTGGAACAACATGACATGGATAGAATGGGAGAGAGAAATTGGCAATTACACAAACCTAATAT ATGAGATACTTACAGAATCGCAGAACCAGCAGGACAGGAATGAAAAGGATTTGTTAGAATTGGATAAATGGGCAAGTCTG TGGAATTGGTTTGACATAACAAATTGGCTGTGGTATATAAAAATATTTATAATGATAGTAGGAGGTTTAATAGGTTTAAG AATAATTTTTGCTGTGCTTTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCTTTGTCTTTCCAGACCCCTTCCCATC ATCAGAGGGAACCCGACAGACCCGAAAGAATCGAAGAAGGAGGTGGCGAGCAAGGCAGAGACAGATCCGTGCGATTAGTG ACCGGATTCTTAGCTCTTGCCTGGGACGACCTACGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTCATCTT GATTGTAGCGAGGACTGTGGAACTCCTGGGACGCAGCAGTCTCAAGGGACTGAGACGGGGGTGGGAAGGCCTCAAATATC TGGGGAACCTTCTGTTATATTGGGGCCAGGAACTAAAAATTAGTGCTATTTCTTTGCTTGATACTACAGCACTAGCAGTA GCGGGGTGGACAGATAGGGTTATAGAAGTAGCACAGGGAGCTTGGAGAGCCATTCTCCACATACCTAGAAGAATCAGACA GGGCTTAGAAAGGGCTTTGGTATAA >01_AE.JP.-.BD187399 ACC BD187399 ATGAGAGTGAAGGAGACACAGATGAATTGGCCAAACTTGTGGAAATG------------------GGGGACTTTGATCCT TGGGTTGGTGATAATTTGTAGTGCCTCAGATAACTTGTGGGTTACAGTTTATTATGGGGTTCCTGTGTGGAGAGATGCAG AT--ACCACCC-TATTTTGTGCATCAGATGCCAAAGCACATGAGACAGAAGTGCACAATGTCTGGGCCACACATGCCTGT GTACCCACAGACCCCAACCCACAAGAAATACACCTGGAAAATGTAACAGAAAATTTTAACATGTGGAAAAATAACATGGT AGAGCAGATGCAGGAGGATGTAATCAGTTTATGGGATCAAAGTCTAAAGCCATGTGTAAAGTTAACTCCTCTCTGCGTTA CTTTAAATTGTACCAATGCT--AATTTG-----------AC--CAATGT---CAA-TA-ACACAA-CCAATGTCTC--TA ACAC--AAT--AGG--AAAT---ATAACA-GAT-GA-AGTAA-GAAACTGTACTTTTAATATGACCACAGAACTAAACGA TAAGAAGAAGATGGTCCATGCACTTTTTTATAAGCTTGATATAGTACAAATAGAAAAT---------------------- ----AA--TAGTAATAGTAAG--TATAGG-T-TAATAAATTGTA-ATACTTCAGTCATTAAGCAGGCTTGTCCAAAGATA TCCTTTGATCCAATTCCTATACATTATTGTACTCCAGCTGGTTATGCGATTTTAAAGTGTAATGATAAGAATTTCAATGG GACAGGGCCATGTAAAAATGTCAGTTCAGTACAATGCACACATGGAATTAAGCCAGTGGTATCAACTCAATTGCTGTTAA ATGGCAGTCTAGCAGAAGAAGAGATAATAATCAGATCTGAAAATCTCACAGACAATGCCAAAACCATAATAGTGCACCTT AATAAATCTGTAGAAATCAATTGTACCAGACCCTCCGAGAATAGAAGAACACGTATAACTATG------GGACCAGGACG AGTATGGTATAGAACAGGAGACATAATAGGAGATATAAGAAAAGCATATTGTAAGATTAATGGAACAAAATGGAATAAAG TTTTAAAACAGGTAACTGA--AAAATTGAAAGAGCACTTTA-AT--AAT---AAGACAATAATCTTTCAA-CCACCCTCA GGAGGAGATCCAGAAATTACAATGCATCATTTTAATTGTAGAGGGGAATTTTTCTATTGCAATACAACACAACTGTTTAA TAGTACTTGC----------ATA--------------AGAAATGAAACC--------AA-GGAGGGG--TG--TAATGGC ACTATCACACTTCCATG-CA-GGATAAAGCAAATTATAAACATGTGGCAGGGAGCAGGACAAGCAATGTATGCTCCTCCC ATCAGTGGAAAAATTAATTGTGTATCAAATATTACAGGAGTACTATTGACAAGAGATGGTGGTGCTAATAAG-------- ---------ACGAAT--AACGAGACCTTCAGACCTGGAG-GAGGAA-ATATAAAGGACAATTGGAGAAGTGAATTATATA AATATAAAGTAGTACAAATTGAACCACTAGGAATAGCACCCACCAGGGCAAAGAGAAGAGTGGTGGAGAGAGAAAAAAGA GCAGTGGGA-ATAGGAATTA--TGATCTTTGGGTTCTTAGG-AG-CAGCAGGAAG-CACTATGGGCGCGGCGTCAATAAC GCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAACAGCAAAGCAATTTGCTGAGGGCTATAGAGGCGCAGC AGCATCTGTTGCAACTCACAGTCTGGGGCATTAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAAGGAT CAAATGTTCCTAGGACTTTGGGGCTGCTCTGGAAAAATCATCTGCACCACTGCTGTGCCCTGGAACTCCACTTGGAGTAA TAAATCTTTTGAAGAGATTTGGAACAACATGACATGGATAGAATGGGAGAGAGAAATTAGCAATTACACAAACCTAATAT ATGGGATACTTACAGAATCGCAGAACCAGCAGGACAGGAATGAAAAAGAGTTGTTAGAATTGGATAAATGGGCAAGTCTG TGGAATTGGTTTGACATAACAAAGTGGCTGTGGTATATAAAAATATTTATAATGATAGTAGGAGGTTTAATAGGTTTAAG AATAATTTTTGCTGTGCTTTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCTTTGTCTCTCCAGACCCCTTCCCATC ATCAGAGGGAACCCGACAGACCCGAAAGAATCGAAGAAGAAGGTGGCGAGCAAGGCAGAGACAGATCCGTGCGATTAGTG ACCGGATTCTTAGCACTTGCCTGGGACGATCTACGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTCATCTT GATTGTAGCGAGGACTGTGGAACTTCTGGGACGCAGCAGTCTCAAGGGACTGAGCCGGGGGTGGGAAGGCCTCAAATATC TGGGGAACCTTCTGTTATATTGGAGCCAGGAACTAAGAATTAGTGCTATTTCTTTGCTTGATGCTACAGCAATAGCAGTA GCGGGGTGGACAGATAGGGTTATAGAAGTAGCACAGGGAGCTTGGAGAGCCATTCTCCACATACCTAGAAGAATCAGACA GGGCTTAGAAAGGGCTTTGGTATAA >B.JP.-.ETR ACC D12582 ATGAGAGTGAAGGAGATCAGGAAGAATTATCAGCACTTGTGGAGATGGGGCATCATGCTCCGATGGGGCACCATGCTCCT TGGGATGTTGATGATCTGTAGTGCTGCAGAACAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAAGAAGCAA CC--ACCACTC-TATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGCACATAATGTTTGGGCCACACATGCTTGT GTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAACATGTGGAAAAATAACATGGT AGAACAAATGCATGAGAATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTA CTTTACATTGCACTGATTTG-------------------AG--GAATAC---TAC-TA-ATAACA-ATAGTAGTAT--CG AGGA--AAA--G-----------ATGAAG-GGA-GA-AATAA-AAAATTGCTCTTTCAATGTCACCACAAACATAAGAGA TAAGGTGCAGAAAGAATATGCACTTTTTTATAAACTTGATGTAGTACCAATAGATAATGAT---------------AATA AT--AG--TACTAATACATGC--TATAGG-T-TGATAAGTTGTG-ACACCTCAGTCATTACCCAGGCCTGTCCAAAGGTA TCCTTTGAGCCAATTCCCATACATTATTGTACCCCGGCTGGGTTTGCGCTTCTAAAGTGTAATAATAAGACATTCAATGG AACAGGACCATGTAAAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAACTCAACTGCTGTTAA ATGGCAGTCTAGCAGAAGAAGGGGTAGTAATTAGATCTGAAAATTTCACAGACAATGTTAAAACCATAATAGTACAGCTG AATGAAACTGTAAAAATTAATTGTATAAGACCCAACAACAAGACAAGAAAAAGGGTAACTATG------GGACCAGGGAG AGTATATTACACAACAGGAGAAATAATAGGAGATATAAGACAAGCACATTGTAACATTAGTAGAGCAGAATGGAATAAAA CTTTAGAACAGATAGCTAA--CAAATTAAGAAAACAATTTG-AG--AAT---AAAACAATAGTCTTTAAT-CAATCCTCA GGAGGGGACCCAGAAATTGTAATGCACAATTTTAATTGTGGAGGGGAATTTTTCTACTGTGATTCATCACAACTGTTTAA TAGTACACACC--TGTCT--AAT--------------GGTACTTGGTGG-----AATGG-TACTGGG--CC--A---GAA AATATCACACTCCCCTG-CA-GAATAAAACAAATTGTAAACATGTGGCAGGAAGTAGGAAAAGCAATGTATGCCCCTCCC ATCAGAGGACAAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAACACCCAGAACAATAA CACCAAT--AGCAGT--ATCGAGATCTTCAGACCTGGAG-GAGGAG-ATATGAGGGACAATTGGAGAAGTGAATTATATA AATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAGGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGA GCAGTGGGA-ATAGGAGCTG--TGTTCCTTGGGTTCTTGGG-AG-CAGCAGGAAG-CACTATGGGCGCAGCGGCAGTGAC GCTGACGGTACAGGCCAGACAATTATTGCCTGGTATAGTGCAACAGCAGAACAATTTGCTGAGGGCTATTGATGCGCAAC AACATCTGTTGCAACTCACAGTCTGGGGCATCAAACAGCTCCAGGCAAGAGTCCTGGCTGTGGAAAGATACCTAAAGGAT CAACAGCTCATGGGGATTTGGGGTTGCTCTGGAAAGTTCATCTGCACCACTGCTGTGCCTTGGAATACTAGTTGGAGTAA TAAATCTTTTAATGAAATTTGGGATAACATGACCTGGATGGAGTGGGAAAGAGAAATTAACAATTACACAAACTTAATAT ACAACTTAATTGAAGAATCGCAGAATCAACAGGAAAAGAATGAACAAGACTTATTGGCATTAGATAAATGGGACAGTTTG TGGAATTGGTTTAGCATAACAAAATGGCTGTGGTATATAAAAATATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAG AATAGTTTTTACTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCATTATCGTTTCAGACCCGCCTCCCAG CTTAGAGGGGACCCGACAGGCCAGAAGGAATCGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCGGTCCATTAGTG GATGGATTATTAGCACTTATCTGGGTCGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTT GATTGTAACGAGGACTGTGGAACTTCTGGGACGCAAG---------------------GGGTGGGAAGTCCTCAAATACT TGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAACGCCACAGCAATAGCAGTA GCTGAGGGGACAGATAGGGTTATAGAAATATTACAAAGAACTTATAGGGCTATCCTCCACATACCTGTAAAAATAAGACA GGGCTTGGAAAGGGCTTTGCTATAA >B.JP.86.JH32 ACC M21138 ATGAGAGTGAAGGGGATCAGGAAGAATTATCAGCACTTGTGGAGATG------------------GGGCACGATGCTCCT TGGGATATTGATGATCTGTAGTGCTGCAGAACAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAAGAAGCAG CC--ACCACTC-TATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGT GTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGAAAATGTGACAGAAAAATTTAACATGTGGAAAAATAACATGGT AGAACAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTA CTTTAAATTGCATTGATTGG--GGGAATGATACTAGC--CC--CAATGC---TAC-TA-ATACCA-CTAGTAGTGG--CG GGGA--AAA--G-----ATG---GAGAAA-GGA-GA-AATGA-AAAACTGCTCTTTCAATATCACCACAAGCATAAGAGA TAAGGTGCAGAAAGAACATGCACTTTTTTATAAACATGATGTAGTACCAATAAATAATAGTACCAAGGATAATATAAAAA AT--GA--TAATAGTACCAGA--TATAGA-T-TAATAAGTTGTA-ACACCTCAGTCATTACACAGGCCTGTCCAAAGATA TCCTTTGAGCCAATTCCCATACATTATTGTGCCCCGGCTGGTTTTGCGATTATAAAGTGTAATGATAAGAAGTTCAATGG AACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTAAGCCAGTAGTATCAACTCAGCTGCTGTTAA ATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGGTCTGAAAATTTCACTGACAATGCTAAAACCATAATAGTACAGCTG AAAGAACCTGTAGTAATTAATTGTACAAGACCCAGCAAGACTACAAGAAGAAGGATACATATA------GGACCAGGGAG AGCATTTTATACAACAAAACAAATAGCAGGAGATTTAAGACAAGCACATTGTAACATTAATAGAGCAAGATGGAATGCCA CTTTAAAACAGATAGTTGG--AAAATTAAGAAAACAATTTG-TG--AAT---AAAACAATAGTCTTTAAT-CGATCCTCA GGAGGGGACCCAGAAATCGTAATGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAA TAGCACTTGGT--TGTCT--AATAG--TACTTGGAATGATACTGAAGGGT-C-AAATAA-CACAGGA--GG--AAATGAC ACAATCACCCTCCCATG-CA-GAATAAAACAAATTATAAACATGTGGCAGGAAGTAGGAAAAGCAATGTATGCCCCTCCC ATCGAAGGACAAATTAGATGCTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTGATAACCAG-------- ---------AACGAG--ACCGAGACCTTCAGACCTGGAG-GAGGAA-ATATGAGGGACAATTGGAGAAGTGAATTATATA AATATAAAGTAGTAAAAATTGAATTATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGA GCAGTGGGA-ATAGGAGCTG--TGTTCCTTGGGTTCTTGGG-AG-CAGCAGGAAG-CACTATGGGCGC---GTCGATGAC GCTGACGGTACAGGCCAGACTATTATTGTCTGGTATAGTGCAACAACAAAACAATTTGCTGAGGGCTATTGAGGGCCAAC AGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGAT CAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAA TAAATCTCTGGAAGAAATTTGGGATAACATGACCTGGATGGAGTGGGAAAGAGAAATTGACAATTACACAAGCTTAATAT ACACCTTAATTGAAGAATCGCAAAACCAACAAGAAAAGAATGAACAAGAATTATTGGGGTTAGATAAATGGGCAAGTTTG TGGAATTGGTTTACTATAACAAACTGGCTGTGGTATATAAGAATATTCATAATGATAGTAGGAGGCTTAGTAGGTTTAAG AATAGTTTTTACTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATACTCACCACTATCGTTTCAGACCCGCCTCCCAG CCCCGAGGGGACCCGACAGGCCCGAAGGAATCGAAGAAGAAGGTGGAGACAGAGACAGAGACAGATCCGGTCAATTAGTG GATGGATTATTAGCAATTATCTGGGTCGACCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTT GATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGG---------------------GGGTGGGAAGCCCTCAAATATT GGTGGAATCTCCTACAATATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGTTCAATGCCATAGCCATAGCAGTA GCTGAGGGGACAGATAGGGTTCTAAAAATATTACAAAGAGCTTTTAGAGCTATTCTCCACATACCTACAAGAATAAGACA GGGCTTGGAAAGGGCTTTGCTATAA >B.FR.83.HXB2 ACC K03455 ATGAGAGTGAAGGAG---------AAATATCAGCACTTGTGGAGATGGGGGTGGAGATG------GGGCACCATGCTCCT TGGGATGTTGATGATCTGTAGTGCTACAGAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAGGAAGCAA CC--ACCACTC-TATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGT GTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGT AGAACAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTA GTTTAAAGTGCACTGATTTG-------------------AA--GAATGA---TAC-TA-ATACCA-ATAGTAGTAG--CG GGAG--AAT--GAT--AATG---GAGAAA-GGA-GA-GATAA-AAAACTGCTCTTTCAATATCAGCACAAGCATAAGAGG TAAGGTGCAGAAAGAATATGCATTTTTTTATAAACTTGATATAATACCAATAGATAAT---------------------- ---------GATACTACCAGC--TATAAG-T-TGACAAGTTGTA-ACACCTCAGTCATTACACAGGCCTGTCCAAAGGTA TCCTTTGAGCCAATTCCCATACATTATTGTGCCCCGGCTGGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAATGG AACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAACTCAACTGCTGTTAA ATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTG AACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAG AGCATTTGTTACAATAGGAAAA---ATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACA CTTTAAAACAGATAGCTAG--CAAATTAAGAGAACAATTTG-GA--AATAATAAAACAATAATCTTTAAG-CAATCCTCA GGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAA TAGTACTTGGT--TT-----AATAG--TACTTGG---AGTACTGAAGGGT-C-AAATAA-CACTGAA--GG--AAGTGAC ACAATCACCCTCCCATG-CA-GAATAAAACAAATTATAAACATGTGGCAGAAAGTAGGAAAAGCAATGTATGCCCCTCCC ATCAGTGGACAAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGCAAC-------- ---------AATGAG--TCCGAGATCTTCAGACCTGGAG-GAGGAG-ATATGAGGGACAATTGGAGAAGTGAATTATATA AATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGA GCAGTGGGA-ATAGGAGCTT--TGTTCCTTGGGTTCTTGGG-AG-CAGCAGGAAG-CACTATGGGCGCAGCCTCAATGAC GCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAAC AGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGAT CAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAA TAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTG TGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAG AATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAA CCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTG AACGGATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTT GATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGG---------------------GGGTGGGAAGCCCTCAAATATT GGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAATGCCACAGCCATAGCAGTA GCTGAGGGGACAGATAGGGTTATAGAAGTAGTACAAGGAGCTTGTAGAGCTATTCGCCACATACCTAGAAGAATAAGACA GGGCTTGGAAAGGATTTTGCTATAA
last modified: Thu Aug 16 15:45 2007


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health