HIV Databases HIV Databases home HIV Databases home
HIV sequence database



Ambiguity Consensus Explanation

Ambiguity Consensus Maker takes an input file of aligned nucleotide sequences and calculates a consensus sequence made up of the IUPAC ambiguity codes for each column in the alignment. The program provides the consensus alone or the consensus appended to the original alignment. A copy of the output file may be downloaded.

A good way to understand the options available in this program is to click the Sample Input button at the top of the submission page. This loads a simple, hypothetical alignment in Table format. You can use this file to test the results of various options. Each column of the Sample Input has been chosen to illustrate one of the IUPAC ambiguity codes. "Sequence11" of the sample input was chosen to illustrate that the tool ignores non-ACGTU characters.


Input file options

Consensus output options

Consensus-making options


Examples

Example of using names to identify alignment blocks:

In the table-formatted file below there are two blocks, an "A1" block and a "B" block recognizable by the "A1." and "B." (note the dot) with which the names begin. Two consensuses will be calculated for this alignment if "Do consensus for each block" is true and "Min. no. seqs. for consensus" is 3.

A1.FR.83.IIIB_A04321 aaactatcgtagctagctagctgatcgatgctagctgatcg.... etc
A1.FR.83.IIIC_A04322 aaactatcgtagctagctag------gatgctagctgatcg.... etc
A1.DE.96.POIURR_A04322 aaactatcgtagctagctag------gatgctagctgatcg.... etc
B.FR.82.LAI_K03455 aaactatcgtagctagctttctgatcgatgctagctgatcg.... etc
B._._.N833_AF76511 acactatcgtagctagctagctgatcgatgctagctgatcg.... etc
B.US.99.JK77_AF76511 acactatcgtagctagctagctgatcgatgctagctgatcg.... etc

Example of "pretty print" output:

CON                     gccagccccc tgaTGGGGGC GACaCTCCAC CATGAATCAC tCCCCTGTGA 
1a.-.COLONEL_AF290978   ---------- --TTGGGGGC GACACTCCAC CATGAATCAC CCCCCTGTGA 
1a.-.H77_AF009606       GCCAGCCCCC TGATGGGGGC GACACTCCAC CATGAATCAC TCCCCTGTGA 
1a.-.HEC278830_AJ278830 GCCAGCCCCC TGATGGGGGC GACGCTCCAC CATGAATCAC TCCCCTGTGA 

CON                     GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCaTGGCG TTAGTATGAG 
1a.-.COLONEL_AF290978   GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCATGGCG TTAGTATGAG 
1a.-.H77_AF009606       GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCATGGCG TTAGTATGAG 
1a.-.HEC278830_AJ278830 GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCGTGGCG TTAGTATGAG 

CON                     TGTCGTGCAG CCTcCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 
1a.-.COLONEL_AF290978   TGTCGTGCAG CCTCCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 
1a.-.H77_AF009606       TGTCGTGCAG CCTTCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 
1a.-.HEC278830_AJ278830 TGTCGTGCAG CCTCCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 

Example of "output aligned" output:

CON                     gccagccccc tgaTGGGGGC GACaCTCCAC CATGAATCAC tCCCCTGTGA 
1a.-.COLONEL_AF290978   .......... ..T------- ---------- ---------- C--------- 
1a.-.H77_AF009606       ---------- ---------- ---------- ---------- ---------- 
1a.-.HEC278830_AJ278830 ---------- ---------- ---G------ ---------- ---------- 

CON                     GGAACTACTG TCTTCACGCA GAAAGCGTCT AGCCaTGGCG TTAGTATGAG 
1a.-.COLONEL_AF290978   ---------- ---------- ---------- ---------- ---------- 
1a.-.H77_AF009606       ---------- ---------- ---------- ---------- ---------- 
1a.-.HEC278830_AJ278830 ---------- ---------- ---------- ----G----- ---------- 

CON                     TGTCGTGCAG CCTcCAGGAC CCCCCCTCCC GGGAGAGCCA TAGTGGTCTG 
1a.-.COLONEL_AF290978   ---------- ---------- ---------- ---------- ---------- 
1a.-.H77_AF009606       ---------- ---T------ ---------- ---------- ---------- 
1a.-.HEC278830_AJ278830 ---------- ---------- ---------- ---------- ---------- 

Example of formatted output (nexus):

#NEXUS

begin taxa;
dimensions ntax=4;
taxlabels
CON
1a._.COLONEL_AF290978
1a._.H77_AF009606
1a._.HEC278830_AJ278830
;
end;

begin characters;
dimensions nchar=150;
format interleave datatype=dna;
matrix
CON                     gccagccccctgaTGGGGGCGACaCTCCACCATGAATCACtCCCCTGTGA
1a._.COLONEL_AF290978   ------------TTGGGGGCGACACTCCACCATGAATCACCCCCCTGTGA
1a._.H77_AF009606       GCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATCACTCCCCTGTGA
1a._.HEC278830_AJ278830 GCCAGCCCCCTGATGGGGGCGACGCTCCACCATGAATCACTCCCCTGTGA

CON                     GGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCaTGGCGTTAGTATGAG
1a._.COLONEL_AF290978   GGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAG
1a._.H77_AF009606       GGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAG
1a._.HEC278830_AJ278830 GGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCGTGGCGTTAGTATGAG

CON                     TGTCGTGCAGCCTcCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTG
1a._.COLONEL_AF290978   TGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTG
1a._.H77_AF009606       TGTCGTGCAGCCTTCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTG
1a._.HEC278830_AJ278830 TGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTG

;
end;

last modified: Mon Dec 16 16:01 2013


Questions or comments? Contact us at seq-info@lanl.gov.

 
Operated by Los Alamos National Security, LLC, for the U.S. Department of Energy's National Nuclear Security Administration
Copyright © 2005-2012 LANS LLC All rights reserved | Disclaimer/Privacy

Dept of Health & Human Services Los Alamos National Institutes of Health